                                                                        Gene putatively regulated by attenuation in C_pneumoniae_J138

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:138 nt.    Distance to gene:30 nt.     Distance to run of Ts=2 nt.   Size=26 nt.     Delta G= -9.00 kcal/mol
Antiterminator:    Distance from promoter:108 nt. Size=45 nt.     Delta G= -6.90 kcal/mol
Anti-antiterminator:    Distance from promoter:88 nt.    Size=32 nt.     Delta G=-11.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tcgatg-taaaat. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tcgatgctatttttccatggctatttttaaaatgatagccatggttatagatacgtagtccttatttcaaagaagacactgttgcattagatacgctctc
tgatccctcaaaatcacattttggtatctgattgctaagattgcaggataccacgcatcttaagagaaaggcgctcttacctagtagaggttgagtgaat
ttcttgacttgtttctcctattggtgtatctcttaaaatattaaATT

    pmp_3_1 --- pmp_3_2 Gene: pmp_3_1     GI: 15835550     BI number: CPj0014     GOG: -------     Description: polymorphic outer membrane protein G family Gene: pmp_3_2     GI: 15835551     BI number: CPj0015     GOG: -------     Description: Pmp_            aa           t  g            ta            cg            ta           |  a   g       |  a a  a      a  g a  t       cg t  t       gc cg        cg         t gc       a  c      g  a ta       c  t      a  g t  |      c  c       ta a  |      a  t       cg g  |      t  t       cg tg       a  a       at cg        gc       t  t ta        gc       t  | at        at        cg ta       |  a       ta gc        cg        cg gc        gt        gt ta        ta        cg                         aatttcttgacttgtttctcctattggtgtatctcttaaaatattaaATT     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_pneumoniae_J138                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:138 nt.    Distance to gene:39 nt.     Distance to run of Ts=2 nt.   Size=26 nt.     Delta G= -9.00 kcal/mol Antiterminator:    Distance from promoter:103 nt. Size=45 nt.     Delta G= -6.90 kcal/mol Anti-antiterminator:    Distance from promoter:88 nt.    Size=32 nt.     Delta G=-11.40 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: tcgatg-taaaat. It has a score value of 60.91 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case tcgatgctatttttccatggctatttttaaaatgatagccatggttatagatacgtagtccttatttcaaagaagacactgttgcattagatacgctctc tgatccctcaaaatcacattttggtatctgattgctaagattgcaggataccacgcatcttaagagaaaggcgctcttacctagtagaggttgagtgaat ttcttgacttgtttctcctattggtgtatctcttaaaatattaaATT     pmp_3_1 --- pmp_3_2 Gene: pmp_3_1     GI: 15835550     BI number: CPj0014     GOG: -------     Description: polymorphic outer membrane protein G family Gene: pmp_3_2     GI: 15835551     BI number: CPj0015     GOG: -------     Description: Pmp_            at           c  c            gt            ct            aa           |  a   g       |  g a  a      c  a a  t       cg t  t       aa cg        ta         t gc       a  a      g  a ta       g  g      a  g t  |      g  g       ta a  |      a  c       cg g  |      c  g       cg tg       g  c       at cg        tt       t  t ta        tc       t  | at        at        cg ta       |  t       ta gc        ga        cg gc        ac        gt ta        ac        cg                         aatttcttgacttgtttctcctattggtgtatctcttaaaatattaaATT     ..................................................................................................................