Gene putatively regulated by attenuation in C_pneumoniae_J138

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:161 nt.     Distance to run of Ts=2 nt.   Size=23 nt.     Delta G= -6.40 kcal/mol
Antiterminator: Size=78 nt.     Delta G= -7.25 kcal/mol
Anti-antiterminator:   Size=37 nt.     Delta G= -9.49 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCCATAGAATACGGGGCTCTAGATGGAAAACCTGTAGGCATTCTTTTCTTCCTTTTTG
CTTGCCAGGATAAAAGTCACTTAAACTTAGTAAATAAAATAGTCCATCTCGGGATGTC
TTTAAATGCCCGAAGCTTTTTTAAAAATTATCCTAACAAAGATCAACTTTTAGCGTAC
GTTAAGGAATGGGAGTCCCAAACTCATTAAtagctagagtttaaaaagatttttaagtccaagttgtgaaaaaaatcc
ttttgttgctatggtgatcctcataggcttccaggagattgtagtcgcATG

    CPj0062


Gene: CPj0062     GI: 15835598     BI number: CPj0062     GOG: NOG07056     Description: CT289 hypothetical protei


           TC
          G  A
          A  C
          A  T
          A  T
          A  A
          T  A
          A  A
           GC
           GT
           AT
          C  A
           CG
           GT
           TA
           TA
          C  A
           GT
           TA
           TA
           TA
 CT        TA
T  T      |  T
T  C       TA
T  C       CG
T  T      |  T
C  T      C  C
T  T      T  C
T  T      T  A       TT
 AT       C  T      C  T
 CG       T  C      T  A
 GC       T  T      G  A
 GT       T  C       TA
 AT        TG        AT
 TG        CG       |  G
|  C       TG        GC
 GC        TA        GC
 TA        AT        GC
 CG        CG        CG
 CG        GT        TA
                        AGCTTTTTTAAAAATTATCCTAACAAAGATCAACTTTTAGCGTACGTTAAGGAATGGGAGTCCCAAACTCATTAAtagctagagtttaaaaagatttttaagtccaagttgtgaaaaaaatccttttgttgctatggtgatcctcataggcttccaggagattgtagtcgcATG


    ..................................................................................................................