Gene putatively regulated by attenuation in C_pneumoniae_J138

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:170 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-24.10 kcal/mol

                                                                        Nomenclature/Definitions

AAGAAGACGCACTACCTGCTGCTAAAGGAAAGAAAAAAGTTGTAACTAAGAAAAAGAA
ATAAaacttcttttagatttcccatttataaaacccattctcaggctctcaagcccgagaatgggtttttttgtgagggctttctctcttgcaatag
cttgtataatacgttatgctttcctaggtcacgataattttgaaatagataacgttagatgcctgtatcagtataccaaggtgttttagagaatttttta
tctgattccatttgatactgatttttcaccactttttagggattcATG

    pfrA --- hemK --- ffh --- rs16 --- trmD --- rl19 --- rnhB_1 --- gmk --- CPj0121 --- metG


Gene: pfrA     GI: 15835649     BI number: CPj0113     GOG: COG0216     Description: peptide chain releasing factor
Gene: hemK     GI: 15835650     BI number: CPj0114     GOG: COG2890     Description: A/G specific methylase
Gene: ffh     GI: 15835651     BI number: CPj0115     GOG: COG0541     Description: signal recognition particle GTPase
Gene: rs16     GI: 15835652     BI number: CPj0116     GOG: COG0228     Description: S16 ribosomal protein
Gene: trmD     GI: 15835653     BI number: CPj0117     GOG: COG0336     Description: tRNA (guanine N-1)-methyltransferase
Gene: rl19     GI: 15835654     BI number: CPj0118     GOG: COG0335     Description: L19 ribosomal protein
Gene: rnhB_1     GI: 15835655     BI number: CPj0119     GOG: COG0164     Description: ribonuclease HII
Gene: gmk     GI: 15835656     BI number: CPj0120     GOG: COG0194     Description: GMP kinase
Gene: CPj0121     GI: 15835657     BI number: CPj0121     GOG: NOG08324     Description: CT031 hypothetical protein
Gene: metG     GI: 15835658     BI number: CPj0122     GOG: COG0143     Description: methionyl-tRNA synthetas


          tc
         c  a
          ta
          cg
          gc
          gc
         a  c
          cg
          ta
          cg
          ta
          ta
          at
          cg
          cg
          cg
          at
          at
          at
            ttttgtgagggctttctctcttgcaatagcttgtataatacgttatgctttcctaggtcacgataattttgaaatagataacgttagatgcctgtatcagtataccaaggtgttttagagaattttttatctgattccatttgatactgatttttcaccactttttagggattcATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[J] COG0216 Protein chain release factor A ... can be seen here
[J] COG2890 Methylase of polypeptide chain release factors ... can be seen here
[U] COG0541 Signal recognition particle GTPase ... can be seen here
[J] COG0228 Ribosomal protein S16 ... can be seen here
[J] COG0336 tRNA-(guanine-N1)-methyltransferase ... can be seen here
[J] COG0335 Ribosomal protein L19 ... can be seen here
[L] COG0164 Ribonuclease HII ... can be seen here
[F] COG0194 Guanylate kinase ... can be seen here
[J] COG0143 Methionyl-tRNA synthetase ... can be seen here

    ..................................................................................................................