Gene putatively regulated by attenuation in C_pneumoniae_J138

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:21 nt.    Distance to gene:108 nt.     Distance to run of Ts=1 nt.   Size=25 nt.     Delta G= -9.30 kcal/mol
Antiterminator:    Distance from promoter:11 nt. Size=24 nt.     Delta G= -4.00 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G= -7.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGCTC-AAGAAT. It has a score value of 61.58 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGCTCAAGGAAATTCTTTTTTTAAAGAATTCTAAataatttaagaatcttccttagggctcttgaagctcgga
ggcttttctaattaaatttacaatggtctaagaattatttttatataaatatttctttataaaaagatgatttttaaatttattaagctgttgttgaatt
aatagcttcttaataaGTG

    CPj0181 --- CPj0180 --- CPj0179 --- CPj0178


Gene: CPj0181     GI: 15835716     BI number: CPj0181     GOG: -------     Description: hypothetical protein
Gene: CPj0180     GI: 15835715     BI number: CPj0180     GOG: -------     Description: hypothetical protein
Gene: CPj0179     GI: 15835714     BI number: CPj0179     GOG: -------     Description: hypothetical protein
Gene: CPj0178     GI: 15835713     BI number: CPj0178     GOG: -------     Description: hypothetical protei


 AT
A  T
 GC
 AT
|  A
|  A
A  a
 At
 Ta
 Ta
T  t
T  t
T  t                  t
 Ta        ct       t  g
 Ta       c  t      c  a
 Cg       t  a       ta
 Ta        tg        cg
 Ta        cg        gc
 At       t  g       gt
|  c      a  c       gc
 At        at       a  g
 At        gc        tg
 Gc        at        ta
 Gc        at        cg
 At        tg        cg
                        cttttctaattaaatttacaatggtctaagaattatttttatataaatatttctttataaaaagatgatttttaaatttattaagctgttgttgaattaatagcttcttaataaGTG
    ..................................................................................................................