                                                                        Gene putatively regulated by attenuation in C_pneumoniae_J138

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:73 nt.    Distance to gene:126 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G= -7.40 kcal/mol
Antiterminator:    Distance from promoter:42 nt. Size=48 nt.     Delta G=-11.02 kcal/mol
Anti-antiterminator:    Distance from promoter:5 nt.    Size=51 nt.     Delta G=-11.87 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: GTGATC-TATTAT. It has a score value of 70.28 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTGATCTTAGCTGTGAGCTTAGTTATTATAGGTTCTCTTTTTCTTCTTGCTGGGGTTG
CCATACTCACAGTATTTTCTCATGGAGTCCTTTCATTAGTTTTTGGGGTTCTTGGGAT
TGTTCTGGGACTTCTTTTATTAGCTGGAGGAGTCGGACTTTTAGTTGAGGAGGCAAAA
TCTTTATTATAGtaccagaaactttgggaaagagaaagagagtatttcaagacaattagagagaaagagcatgctactattagcactATG

    CPj0210 Gene: CPj0210     GI: 15835745     BI number: CPj0210     GOG: -------     Description: hypothetical protei CC G  A        A T  T      T  G TA       T  T GC       A  T GT       C  T GC       T  T |  A      T  T GC        TG TA        CG CG        CG GT       T  G       TG TA       G  T      T  T T  T       AT        AT C  T       GC        GC T  T       GT        GT T  T      T  |      G  | C  C       AT       T  | T  T       CG        TG T  C       TG        CG T  A       CG        TG T  T       TA        TA TG       T  T       GC CG       T  T       GT TA        TG        GT CG        AT        GC                         TTTTATTAGCTGGAGGAGTCGGACTTTTAGTTGAGGAGGCAAAATCTTTATTATAGtaccagaaactttgggaaagagaaagagagtatttcaagacaattagagagaaagagcatgctactattagcactATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_pneumoniae_J138                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:185 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G= -7.90 kcal/mol Antiterminator: Size=47 nt.     Delta G= -7.50 kcal/mol Anti-antiterminator:   Size=21 nt.     Delta G= -4.70 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CAGATACAACAGAAGAGGTGCTTTAAACAAAGTACTTTTGTGATCTTAGCTGTGAGCT TAGTTATTATAGGTTCTCTTTTTCTTCTTGCTGGGGTTGCCATACTCACAGTATTTTC TCATGGAGTCCTTTCATTAGTTTTTGGGGTTCTTGGGATTGTTCTGGGACTTCTTTTA TTAGCTGGAGGAGTCGGACTTTTAGTTGAGGAGGCAAAATCTTTATTATAGtaccagaaact ttgggaaagagaaagagagtatttcaagacaattagagagaaagagcatgctactattagcactATG     CPj0210 Gene: CPj0210     GI: 15835745     BI number: CPj0210     GOG: -------     Description: hypothetical protei             C           T  T           C  T           T  T           T  T            GT            GC            AT           T  T           A  C           T  T           T  T           A  |       CC           T  |      G  A   A        TG       T  T T  T       GC        TA T  T       AT        GC G  A       TG        GT AT        TG        GC TA        CG       |  A TG       G  G       GC CG        AT        TA GT        GT        CG AT        TG        GT GC        GC        TA                         TTTTCTCATGGAGTCCTTTCATTAGTTTTTGGGGTTCTTGGGATTGTTCTGGGACTTCTTTTATTAGCTGGAGGAGTCGGACTTTTAGTTGAGGAGGCAAAATCTTTATTATAGtaccagaaactttgggaaagagaaagagagtatttcaagacaattagagagaaagagcatgctactattagcactATG     ..................................................................................................................