                                                                        Gene putatively regulated by attenuation in C_pneumoniae_J138

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:143 nt.    Distance to gene:59 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-17.10 kcal/mol
Antiterminator:    Distance from promoter:127 nt. Size=32 nt.     Delta G= -4.10 kcal/mol
Anti-antiterminator:    Distance from promoter:100 nt.    Size=43 nt.     Delta G= -5.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTTATC-AAGAAT. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTATCAAGTCTTTATGGTTTATAAGAATAAGAATCCTCAGGCCTTGGATAAAGAATA
CGAGGCGTTTTCTCAGTCTTTTAAAATTACTAAAATACGAGAACCAAGAACGATTCCT
TCTTCAGTGAAAAAGAAAGTAAGTCTGTAAgattctatattttggatttgtgttttaagaaccattgccgggttggca
atggtttttttatttatattctcaatatactaggcatctgaaagctctaattcttgagaaaaagcaaggactATG

    CPj0233 Gene: CPj0233     GI: 15835768     BI number: CPj0233     GOG: -------     Description: hypothetical protei   t c  a t  t ta at gt At         a At       t  a        g T  |       tg       g  t G  |       ta       g  t Tg        ta        cg Cg        gc        cg Ta       t  |       gc Gt        gc        ta At        ta        ta At       t  t       at Tg       t  t       cg G  t      a  g       cg A  g       gc        at At        gc        at At        tg        gt Gt        tg        at At        tg        at                         ttatttatattctcaatatactaggcatctgaaagctctaattcttgagaaaaagcaaggactATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_pneumoniae_J138                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:187 nt.     Distance to run of Ts=1 nt.   Size=23 nt.     Delta G= -7.30 kcal/mol Antiterminator: Size=44 nt.     Delta G= -5.10 kcal/mol Anti-antiterminator:   Size=31 nt.     Delta G= -5.20 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TTCAGAGGGATGTTGATTTCCGTAAATCACACTCTTTATCAAGTCTTTATGGTTTATA AGAATAAGAATCCTCAGGCCTTGGATAAAGAATACGAGGCGTTTTCTCAGTCTTTTAA AATTACTAAAATACGAGAACCAAGAACGATTCCTTCTTCAGTGAAAAAGAAAGTAAGT CTGTAAgattctatattttggatttgtgttttaagaaccattgccgggttggcaatggtttttttatttatattctcaatatactaggcatctgaa agctctaattcttgagaaaaagcaaggactATG     CPj0233 Gene: CPj0233     GI: 15835768     BI number: CPj0233     GOG: -------     Description: hypothetical protei            GA           A  A            AT            TA           A  A GT        TG T  C       TA A  A       TA tA        GT cG        GC aT       T  C        A gC       A  T      A  G gT       T  C      A  A aT        TA       T  A aT        TG       A  T |  A       CG       G  A |  T      T  C       GC |  G       GC        TG cG        AT        TA gT        AT        CG aT        CG        CG aT        TG        GC                         GTTTTCTCAGTCTTTTAAAATTACTAAAATACGAGAACCAAGAACGATTCCTTCTTCAGTGAAAAAGAAAGTAAGTCTGTAAgattctatattttggatttgtgttttaagaaccattgccgggttggcaatggtttttttatttatattctcaatatactaggcatctgaaagctctaattcttgagaaaaagcaaggactATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_pneumoniae_J138                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:196 nt.     Distance to run of Ts=1 nt.   Size=23 nt.     Delta G= -7.30 kcal/mol Antiterminator: Size=44 nt.     Delta G= -5.10 kcal/mol Anti-antiterminator:   Size=34 nt.     Delta G= -5.20 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TTCAGAGGGATGTTGATTTCCGTAAATCACACTCTTTATCAAGTCTTTATGGTTTATA AGAATAAGAATCCTCAGGCCTTGGATAAAGAATACGAGGCGTTTTCTCAGTCTTTTAA AATTACTAAAATACGAGAACCAAGAACGATTCCTTCTTCAGTGAAAAAGAAAGTAAGT CTGTAAgattctatattttggatttgtgttttaagaaccattgccgggttggcaatggtttttttatttatattctcaatatactaggcatctgaa agctctaattcttgagaaaaagcaaggactATG     CPj0233 Gene: CPj0233     GI: 15835768     BI number: CPj0233     GOG: -------     Description: hypothetical protei            TA           A  A            TG TA        TA T  T      T  A GC        GT TA        GA A  |       TA tA        AG cG        TA aT       T  A        A gC       T  T      A  G gT       C  C      A  A aT        TC       T  A aT        GT       A  T |  A       AC       G  A |  T      A  A       GC |  G       CG        TG cG        TG        TA gT        AC        CG aT        TC        CG aT        TT        GC                         GTTTTCTCAGTCTTTTAAAATTACTAAAATACGAGAACCAAGAACGATTCCTTCTTCAGTGAAAAAGAAAGTAAGTCTGTAAgattctatattttggatttgtgttttaagaaccattgccgggttggcaatggtttttttatttatattctcaatatactaggcatctgaaagctctaattcttgagaaaaagcaaggactATG     ..................................................................................................................