Gene putatively regulated by attenuation in C_pneumoniae_J138

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:114 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G= -8.70 kcal/mol
Antiterminator: Size=38 nt.     Delta G= -4.10 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G= -6.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TAAGTATACAAACCTTGTTGTCATTCGTTCTGAAGACGTAGGTTCTCCTAAAATGATA
AAATTACAGAAGCTGTTTCAATCTCCTTCTGTACAACATTTTTTTGATACAAAATATC
ATGGGAATATTTTGACAATGACTCAAGACAATGGTTAGagcaataagtcgttgtacttgtgcgctctttttg
atcttatttccttcaataaaatatttcgatcttttacccgaaatattttattgaaggaaaagaagttctcataaagaatctaccccccctaattttctac
ggtgtaattctaATG

    CPj0277


Gene: CPj0277     GI: 15835812     BI number: CPj0277     GOG: -------     Description: hypothetical protei


 TG
A  G
 CG
 TA
|  A
 AT
 TA
 AT
 AT
 AT
 AT        AT
 CG       A  G
|  A       CG
|  C       AT
|  A       GT
|  A      A  A
|  T      A  |       tt
|  G       CG       g  g
A  A       Ta       c  t
T  C       Cg        ta
 AT       A  |       gc
 GC        Gc        at
 TA        Ta        at
 TA       |  a       tg
 TG       |  t       at
 TA       A  a      |  g
T  C      A  a      a  c
 TA        Cg        cg
 TA        At        gc
 AT        Gc        at
 CG        Tg        Gc
                        tttttgatcttatttccttcaataaaatatttcgatcttttacccgaaatattttattgaaggaaaagaagttctcataaagaatctaccccccctaattttctacggtgtaattctaATG


    ..................................................................................................................