Gene putatively regulated by attenuation in C_pneumoniae_J138

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:29 nt.     Distance to run of Ts=2 nt.   Size=23 nt.     Delta G= -6.90 kcal/mol
Antiterminator: Size=60 nt.     Delta G= -9.50 kcal/mol
Anti-antiterminator:   Size=23 nt.     Delta G= -6.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GATAGACTCAGCTGTTTCCTTATAGTTTTGCTTAGCAAGTAGCGATGTTTTAGGGATG
CTAATCCCCAAGAAACCATAGATAGAAGACAGTAGGTAAAAAAAGAAGAAAGGGGGTC
TAGGGCTATTGCGGTAGCTTTTAGCAAGAGTTTCATTCCTGCTGATATCCACAAAATA
CCAGGAAATAGTATCAGGAAATATTTGATGTTTCTTGCCATagtgcattacacttaatttctaaatactc
tattttacttggagtatgaattttttgctaactggtattaagatatgcgagctgagATG

    lgt


Gene: lgt     GI: 15835846     BI number: CPj0311     GOG: COG0682     Description: prolipoprotein diacylglycerol transferas


           CC
          G  A
          T  T
           Ta
           Cg
          T  t
          T  |
           Tg
           Gc
           Ta
           At
           Gt
           Ta
          |  c
          |  a
          |  c
          T  t
          T  t
          A  a
           Ta
  T        At         t
T  G       At       t  a
 TA        At       t  c
 AT        Gc       t  t
 TG        Gt        at
 AT       A  a       tg
 AT       C  a       cg
 AT        Ta        ta
 GC        At        cg
 GT        Ta        at
 AT        Gc        ta
 CG        At        at
                        gaattttttgctaactggtattaagatatgcgagctgagATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[M] COG0682 Prolipoprotein diacylglyceryltransferase ... can be seen here

    ..................................................................................................................