                                                                        Gene putatively regulated by attenuation in C_pneumoniae_J138

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:176 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G= -7.90 kcal/mol
Antiterminator: Size=48 nt.     Delta G= -5.30 kcal/mol
Anti-antiterminator:   Size=39 nt.     Delta G= -8.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

attcttattgaataagataattcactatttttagatcctaaattttaagtggtttttgttatgcttcttatagagaatagctgcaaagattagagttgca
gagacggtacgtctctttcttttttaagggaaggggtgttgttacacccatcctaagatttgtgagattcccctcaggcagtaacttttacaatcgtact
ttatgttttgatctagctgttttcttgtctttaatttattcaaccatcgagaagagagatccatgagtggaaatgtattttattaggatcatctctaagg
ATG

    yxjG_2 Gene: yxjG_2     GI: 15835981     BI number: CPj0448     GOG: COG0620     Description: hypothetical protei             t           t  a           a  g           g  a           a  g            at            at            cg            gc   t        ta a  a       cg tg       g  | ta       a  | cg       t  | ta       a  |        t |  a      a  |      g  a |  t      g  |       gc ta       a  |       cg cg       g  |       at gc       a  |       gc t  t      t  |       at a  |      a  |       gc t  |      t  |       at tg        ta       c  | gc        cg       g  | ta        ta       t  | ta       |  c      t  | ta        tg        gt tg        cg        at ta        gt        gc gt        ta        at                         tttttaagggaaggggtgttgttacacccatcctaagatttgtgagattcccctcaggcagtaacttttacaatcgtactttatgttttgatctagctgttttcttgtctttaatttattcaaccatcgagaagagagatccatgagtggaaatgtattttattaggatcatctctaaggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0620 Methionine synthase II (cobalamin-independent) ... can be seen here     ..................................................................................................................