                                                                        Gene putatively regulated by attenuation in C_pneumoniae_J138

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:103 nt.    Distance to gene:94 nt.     Distance to run of Ts=2 nt.   Size=34 nt.     Delta G=-16.50 kcal/mol
Antiterminator:    Distance from promoter:87 nt. Size=34 nt.     Delta G= -7.60 kcal/mol
Anti-antiterminator:    Distance from promoter:61 nt.    Size=37 nt.     Delta G=-10.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaaa-tttatt. It has a score value of 64.26 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgaaattagaagacaaaaattttttatttccctagaatggctttgcatgtaagcgccttagtgtattccatgctgatggtgtgatctccaagggagtta
ggatttttagaaaattctttctcttttcttctgggcttgaaaggggtaggttcgtctttcaagccttctttgttatactgaaaaaataatctgtgtgcta
tcttagctttgccctcgtgtaatttaatacgataaattcaagagttttgcgcgacgggattaaaggttATG

    CPj0692 --- abcX --- CPj0690 --- yfhO_1 Gene: CPj0692     GI: 15836224     BI number: CPj0692     GOG: COG0719     Description: ABC transporter Gene: abcX     GI: 15836223     BI number: CPj0691     GOG: COG0396     Description: ABC transporter ATPase Gene: CPj0690     GI: 15836222     BI number: CPj0690     GOG: COG0719     Description: ABC transporter membrane protein Gene: yfhO_1     GI: 15836221     BI number: CPj0689     GOG: COG0520     Description: NifS-related aminotransferas   a t  g                  g ta        gg       a  g ta       t  g      t  t ta       c  c       gt ta       t  t       gc at       t  t      |  g gt        cg        gt gc        ta        gc at        ta        at t  t       ta        at t  t       tg        at gc        cg        gc at        tg        ta gc        cg        ta gt       t  t       cg gt        ta        gc at        tg        gc at        cg        gt                         tctttgttatactgaaaaaataatctgtgtgctatcttagctttgccctcgtgtaatttaatacgataaattcaagagttttgcgcgacgggattaaaggttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0719 ABC-type transport system involved in Fe-S cluster assembly, permease component ... can be seen here [O] COG0396 ABC-type transport system involved in Fe-S cluster assembly, ATPase component ... can be seen here [O] COG0719 ABC-type transport system involved in Fe-S cluster assembly, permease component ... can be seen here [E] COG0520 Selenocysteine lyase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_pneumoniae_J138                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:64 nt.    Distance to gene:140 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G= -8.30 kcal/mol Antiterminator:    Distance from promoter:36 nt. Size=33 nt.     Delta G= -5.40 kcal/mol Anti-antiterminator:    Distance from promoter:1 nt.    Size=50 nt.     Delta G= -8.90 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttgaaa-tttatt. It has a score value of 64.26 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttgaaattagaagacaaaaattttttatttccctagaatggctttgcatgtaagcgccttagtgtattccatgctgatggtgtgatctccaagggagtta ggatttttagaaaattctttctcttttcttctgggcttgaaaggggtaggttcgtctttcaagccttctttgttatactgaaaaaataatctgtgtgcta tcttagctttgccctcgtgtaatttaatacgataaattcaagagttttgcgcgacgggattaaaggttATG     CPj0692 --- abcX --- CPj0690 --- yfhO_1 Gene: CPj0692     GI: 15836224     BI number: CPj0692     GOG: COG0719     Description: ABC transporter Gene: abcX     GI: 15836223     BI number: CPj0691     GOG: COG0396     Description: ABC transporter ATPase Gene: CPj0690     GI: 15836222     BI number: CPj0690     GOG: COG0719     Description: ABC transporter membrane protein Gene: yfhO_1     GI: 15836221     BI number: CPj0689     GOG: COG0520     Description: NifS-related aminotransferas   g c  c gc at at ta g  | tg at cg gt        tg ta       g  t        a t  t      g  g      t  g t  t       ta        ta c  |       at        ta gc        gc        ta gc       t  t       ta ta       c  c       at at        gc        gt a  g       ta        gc gc       |  a       at at       a  g      t  t tg        cg       t  t |  a       cg        gc c  t       ta        at cg        tg        gc cg        at        gt                         tttcttctgggcttgaaaggggtaggttcgtctttcaagccttctttgttatactgaaaaaataatctgtgtgctatcttagctttgccctcgtgtaatttaatacgataaattcaagagttttgcgcgacgggattaaaggttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0719 ABC-type transport system involved in Fe-S cluster assembly, permease component ... can be seen here [O] COG0396 ABC-type transport system involved in Fe-S cluster assembly, ATPase component ... can be seen here [O] COG0719 ABC-type transport system involved in Fe-S cluster assembly, permease component ... can be seen here [E] COG0520 Selenocysteine lyase ... can be seen here     ..................................................................................................................