                                                                        Gene putatively regulated by attenuation in C_pneumoniae_J138

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:40 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-10.30 kcal/mol
Antiterminator: Size=34 nt.     Delta G= -3.30 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G= -6.04 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCTAACTATGATCCTAAAGAGGCTAATGGTTTTACAAATTATAAAGGATTTTCCGCTC
TATATATGTATGGCATCACAGATTCTCTATCATTCAGAGCTTATGGGGCTTACTCCAA
ACCAGCAAACGATAAACTCGGCAGTGATTTTACTTTCCGAAAGTTTGATCTAGGTATA
ATTTCAGCGTTTTAAgtcaaattttaataaaatctttaaaaacaggctcgcattaattattagtgagagctttttttttattttttata
ataaaactaaaagatttttattattttttgagtttttATG

    CPj0728 Gene: CPj0728     GI: 15836260     BI number: CPj0728     GOG: COG0840     Description: CHLPN 76 kDa homolog_1 (CT622 TT T  C A  A A  G T  C A  G       aa T  T      a  t GT       a  c        t GT       t  t      t  a AT        at        at TA        at        at C  A       ta        ta T  g       ta        tg At        ta        at Gc        ta        cg Ta       a  a      g  a Ta       a  c       cg Ta       a  a       ta Gt        cg        cg At        tg        gc At        gc        gt At        At        at                         tttttttattttttataataaaactaaaagatttttattattttttgagtttttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [NT] COG0840 Methyl-accepting chemotaxis protein ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_pneumoniae_J138                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:47 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-10.30 kcal/mol Antiterminator: Size=34 nt.     Delta G= -3.30 kcal/mol Anti-antiterminator:   Size=44 nt.     Delta G= -6.04 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GCTAACTATGATCCTAAAGAGGCTAATGGTTTTACAAATTATAAAGGATTTTCCGCTC TATATATGTATGGCATCACAGATTCTCTATCATTCAGAGCTTATGGGGCTTACTCCAA ACCAGCAAACGATAAACTCGGCAGTGATTTTACTTTCCGAAAGTTTGATCTAGGTATA ATTTCAGCGTTTTAAgtcaaattttaataaaatctttaaaaacaggctcgcattaattattagtgagagctttttttttattttttata ataaaactaaaagatttttattattttttgagtttttATG     CPj0728 Gene: CPj0728     GI: 15836260     BI number: CPj0728     GOG: COG0840     Description: CHLPN 76 kDa homolog_1 (CT622 TT T  C A  A A  G T  C A  G       at T  T      a  a GT       t  a        t GT       t  a      t  a AT        ta        at TA        tt        at C  A       ac        ta T  g       at        tg At        at        at Gc        ct        cg Ta       t  a      g  a Ta       g  a       cg Ta       A  a       ta Gt        Aa        cg At        Ta        gc At        Tc        gt At        Ta        at                         tttttttattttttataataaaactaaaagatttttattattttttgagtttttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [NT] COG0840 Methyl-accepting chemotaxis protein ... can be seen here     ..................................................................................................................