Gene putatively regulated by attenuation in C_pneumoniae_J138

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:169 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-11.20 kcal/mol
Antiterminator: Size=33 nt.     Delta G= -7.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gaaacatctaagataccgtaaatcgttcttataaggcattctgacagtgtttttgcttttttaaatctatctatacgtgaattggggttttgtataacat
cccttgtttattgggggatgaaatatttttttggatagaattctatcctaaacttcgtgatcagaaaatgactatatctaaagatttcaatttctgatca
cgaagctttttcttttgtctccttttaaatcaataaattctcaaaggacccgcattttgttgtgtgctgattacaagagaagtactaaggagaaaaattt
ATG

    CPj0735


Gene: CPj0735     GI: 15836267     BI number: CPj0735     GOG: COG0572     Description: uridine kinas


  t         t
a  a      t  a
t  a      t  t
 gc        gt
 ta        tg
t  t       tg
t  |       cg
t  |       cg
 gc        cg
 gc        ta
 gc        at
 gt        cg
t  t      a  a
 tg       a  a
 at        ta
 at        at
 gt        ta
 ta        gt
            ttttttggatagaattctatcctaaacttcgtgatcagaaaatgactatatctaaagatttcaatttctgatcacgaagctttttcttttgtctccttttaaatcaataaattctcaaaggacccgcattttgttgtgtgctgattacaagagaagtactaaggagaaaaatttATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[F] COG0572 Uridine kinase ... can be seen here

    ..................................................................................................................