Gene putatively regulated by attenuation in C_pneumoniae_J138

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:148 nt.    Distance to gene:3 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-12.20 kcal/mol
Antiterminator:    Distance from promoter:115 nt. Size=50 nt.     Delta G= -8.52 kcal/mol
Anti-antiterminator:    Distance from promoter:78 nt.    Size=59 nt.     Delta G=-13.35 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGGCT-GATGAT. It has a score value of 62.92 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGGCTTACTTTTTCAAATAAAAGATGATTTTTCAGATTTACAAAAAGACTCCCAACA
AATTGGGCTAAATTATGCTTTACTATTTGGAGAAAAGGCCGCTCTAGAGCTATTAGCA
AGATCTCAAAACAATTGCTTAGAGCTCTTGGATCGTCTCAGTGCTGGTGGATTAAAGA
ATAGTTCTGAATTCGAAACGATTATCTCGAGTTTAGGATCTTTTTAAATC

    CPj0747B


Gene: CPj0747B     GI: 15836280     BI number: CPj0747B     GOG: -------     Description: CT631 hypothetical protei


  A
T  G
T  A
 CG
 GC         T
T  T      T  A
T  C      A  A
 AT       G  A
 AT       G  G
 CG       T  A
A  G      G  A
A  A       GT
A  T       TA        AT
A  C       CG       G  T
C  G       GT       C  A
T  T      T  T      A  T
C  C       GC       A  C
T  T       AT        AT
A  C       CG        GC
G  A       TA        CG
A  G      |  A       TA
 AT       C  T       TG
 CG       T  T       AT
 GC        GC        AT
 AT        CG        GT
 TG        TA        TA
 TG       A  A       CG
 AT       G  A       TG
 TG        GC        TA
 CG        TG        GT
                        CTTTTTAAATC


    ..................................................................................................................