Gene putatively regulated by attenuation in C_pneumoniae_J138

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:28 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-10.70 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -3.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

catgcttgtttataacgaatacgttcttgtcaattatgaaatcacgacctcttaggtcgctaaaatgccattaatgcaagtatacttctgggtattaaaa
aagaaaacaatatttaccgagggaacgtttgctttttctgggatatataggcgaggttcaatacagaatcagcgaagaaaaaagcaatgctgaaaattaa
tctttaggtctaaaataagcacagggtcctcttcttaatgagatgcatgcatttatgaaggggggttctttttgaaatcttgattacagtgagtgagaat
ATG

    lpdA --- lipA


Gene: lpdA     GI: 15836366     BI number: CPj0833     GOG: COG1249     Description: lipoamide dehydrogenase
Gene: lipA     GI: 15836365     BI number: CPj0832     GOG: COG0320     Description: lipoate synthetas


 gt        at
g  c      c  g
 gc        gc
 at        ta
c  c       at
a  t       gt
c  t       at
 gc       g  a
 at       t  t
 at       a  g
 ta       a  |
a  a       ta
a  t       ta
a  g       cg
a  |       tg
 ta        tg
 cg        cg
 ta        tg
 gt        cg
            ttctttttgaaatcttgattacagtgagtgagaatATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[C] COG1249 Pyruvate/2-oxoglutarate dehydrogenase complex, dihydrolipoamide dehydrogenase (E3) component, and related enzymes ... can be seen here
[H] COG0320 Lipoate synthase ... can be seen here

    ..................................................................................................................