                                                                        Gene putatively regulated by attenuation in C_pneumoniae_J138

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:85 nt.     Distance to run of Ts=3 nt.   Size=24 nt.     Delta G=-14.50 kcal/mol
Antiterminator: Size=70 nt.     Delta G= -8.91 kcal/mol
Anti-antiterminator:   Size=40 nt.     Delta G= -5.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGATCTCGCTAAAGGAGATAAAGTCACTGCCATGGGAATCATCGGCACTGTTGACGAT
ATCCGTGAGCACACGGTAATTTTAAATATTGCTTCTGGAAAAGTAGAAGTTTTAAAAG
GAGCTATTTCTGAAATCCTCAAGCCTAACGATAACAAATCATAAggaatttcttttgagactttcat
cccacgattaaaatcgtgggatttcttatttaatggcctaaggtttattgcttttttatgcgctaggttataatttgactctatgagcttttcataaagt
ctgggatttttatcgttATG

    nqr6 Gene: nqr6     GI: 15836416     BI number: CPj0883     GOG: COG2871     Description: phenolhydrolase/NADH ubiquinone oxidoreductase             C           A  A           A  A            TA            AT            GC           C  A           A  T           A  A            TA            Cg            Cg           |  a           |  a           |  t           |  t           |  t           |  c           |  t            Gt            At AA        At A  A       Cg TG        Ta TG        Cg TA       C  a TG       T  c GC        At AT        At |  A       At |  T       Gc |  T       Ta        aa AT       C  |      t  a GC       T  |       ta AT       T  |       at TG       T  |       gc G  A      A  |       cg A  A      T  |       at A  A      C  |       cg A  |      G  |       cg AT        At        cg GC        Gc        ta GC        Gc        at                         ttcttatttaatggcctaaggtttattgcttttttatgcgctaggttataatttgactctatgagcttttcataaagtctgggatttttatcgttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG2871 Na+-transporting NADH:ubiquinone oxidoreductase, subunit NqrF ... can be seen here     ..................................................................................................................