Gene putatively regulated by attenuation in C_pneumoniae_J138

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:172 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G= -6.30 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -4.40 kcal/mol
Anti-antiterminator:   Size=78 nt.     Delta G=-14.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCTCGGCCTTACCGCTTGGCTATGCCACCaaaggggaggatgagaatccttagtttaagcgaaagaagattttatggta
agcgagaagtgcgcataattctagagactagggaaatcttagtcgtttttgagagatgcaattgcattttagttctcttaaaaaagaggttatgtaatca
acctaataagggtacttgcattcttgtctgcattttaaatatagtactttttagtgtaggtccatccttctggtagggagttcagactttctaaaaccat
agatgctgtaggcaaaattatATG

    Cys --- murF --- mraY --- murD --- nlpD --- ftsW --- murG


Gene: murF     GI: 15836432     BI number: CPj0899     GOG: COG0770     Description: muramoyl-DAP ligase
Gene: mraY     GI: 15836433     BI number: CPj0900     GOG: COG0472     Description: muramoyl-pentapeptide transferase
Gene: murD     GI: 15836434     BI number: CPj0901     GOG: COG0771     Description: muramoylalanine-glutamate ligase
Gene: nlpD     GI: 15836435     BI number: CPj0902     GOG: COG1388     Description: muramidase
Gene: ftsW     GI: 15836436     BI number: CPj0903     GOG: COG0772     Description: cell division protein ftsW
Gene: murG     GI: 15836437     BI number: CPj0904     GOG: COG0707     Description: peptidoglycan transferase
Gene: murC_ddlA     GI: 15836438     BI number: CPj0905     GOG: COG0773,COG1181     Description: muramate-Ala ligase/D-Ala-D-Ala ligas


 ag
g  a
 ta
 at
 gc
 gc
 at
 gt
|  a
|  g
|  t
|  t
|  t
|  a
|  a
|  g
|  c
|  g
|  a
|  a
|  a
|  g
|  a
g  a
g  g
g  a       gc
 at       c  a
 at       g  t
 at       t  a
C  t      g  a
C  a       at
 At        at
 Cg        gc
 Cg        at
 Gt       g  a
 Ta       c  g
A  |      g  a
 Ta       a  g
 Cg       a  |        a
 Gc        ta       a  a
|  g       gc       g  t
|  a       gt        gc
G  g       ta        gt
 Ta       a  g       at
 Ta       t  g       ta
 Cg        tg        cg
 Gt        ta        at
 Cg        ta        gc
                        gtttttgagagatgcaattgcattttagttctcttaaaaaagaggttatgtaatcaacctaataagggtacttgcattcttgtctgcattttaaatatagtactttttagtgtaggtccatccttctggtagggagttcagactttctaaaaccatagatgctgtaggcaaaattatATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[M] COG0770 UDP-N-acetylmuramyl pentapeptide synthase ... can be seen here
[M] COG0472 UDP-N-acetylmuramyl pentapeptide phosphotransferase/UDP-N-acetylglucosamine-1-phosphate transferase ... can be seen here
[M] COG0771 UDP-N-acetylmuramoylalanine-D-glutamate ligase ... can be seen here
[M] COG1388 FOG: LysM repeat ... can be seen here
[D] COG0772 Bacterial cell division membrane protein ... can be seen here
[M] COG0707 UDP-N-acetylglucosamine:LPS N-acetylglucosamine transferase ... can be seen here
[M] COG0773 UDP-N-acetylmuramate-alanine ligase ... can be seen here
[M] COG1181 D-alanine-D-alanine ligase and related ATP-grasp enzymes ... can be seen here

    ..................................................................................................................