Gene putatively regulated by attenuation in C_pneumoniae_J138

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:90 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-17.80 kcal/mol
Antiterminator: Size=32 nt.     Delta G= -6.70 kcal/mol
Anti-antiterminator:   Size=77 nt.     Delta G=-19.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCGTCGTTTAGAGAGAATTGGGTTGAAGCCTATCTATCACTCCAGAAATCCTTTCCCT
TGGATGAGCGAAACCATGGATCTGAATAAAGAAAAGAATTTCTTTGAAACCCGGGTTA
CCGAATACCAAACCGCTGGTAATTTAAGTTGGTAAtttcacctctttttcaagggagttttgagagatggtctt
agatcgtctctcaggatttttcagctttcccttccgaagaaagtccttagaaaaaacttcaagaagctttatactttcctaaagcaaacagtctctgatt
tctgctttttATG

    yggH


Gene: yggH     GI: 15836517     BI number: CPj0986     GOG: COG0220     Description: rRNA methylas


 CC
A  G
A  C
 AT
 CG
 CG
 AT
 TA
|  A
|  T
|  T
|  T
|  A
|  A
A  G
 AT
 GT
 CG
 CG
 AT
 TA
|  A
|  t
|  t
|  t
|  c
 Ta
 Gc         a         t
 Gc       g  g      t  a
 Gt       g  t       cg
C  c       gt        ta
C  t       at        gt
C  t       at        gc
 At        cg        tg
 At        ta        at
 At        tg        gc
 Gc        ta        at
 Ta        tg        gc
 Ta        ta        at
 Tg       c  t       gc
 Cg       t  |       ta
 Tg        cg        tg
 Ta        cg        tg
 Tg        at        ta
                        tttttcagctttcccttccgaagaaagtccttagaaaaaacttcaagaagctttatactttcctaaagcaaacagtctctgatttctgctttttATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[R] COG0220 Predicted S-adenosylmethionine-dependent methyltransferase ... can be seen here

    ..................................................................................................................