Gene putatively regulated by attenuation in C_pneumoniae_J138
Characteristics of the secondary structures
Terminator: Distance to gene:129 nt. Distance to run of Ts=0 nt. Size=21 nt. Delta G= -8.40 kcal/mol
Antiterminator: Size=60 nt. Delta G=-16.04 kcal/mol
Anti-antiterminator: Size=65 nt. Delta G=-11.39 kcal/mol
Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
ttggttggtactaagatagtagcaacgcagcagcgagttgcagcatttgaatccatagaagttcctgagattcctgaggccccagaggagaaaccgagtt
tgctggataaagcgcgttctttatttactcgcgaggaccattcctagcataactccaagagttgtgtttctttaaaaattctttgaataaaatactatat
gttagtagcttagtggggttaacttatgtgcttgagcatgatggcgcctttttgtctgtctaaatttcgtgttttagcaatcacttttttagttcttggt
GTG
CPj1055 --- CPj1056
Gene: CPj1055 GI: 15836586 BI number: CPj1055 GOG: ------- Description: hypothetical protein
Gene: CPj1056 GI: 15836587 BI number: CPj1056 GOG: ------- Description: hypothetical protei
tt
a c
gc
at a
g g t t
ta t t
cg t t
cg c a
t c t c
t c t t
g c gc
a c cg
a a gc
g g cg
a a | a
t | | g
a | | g
cg g a
cg a c
ta a c
| g a a
| a t t
| a at
a a gc
a c gc
gc | t a
tg ta c a
ta cg cg
tg gc ta
| t ta cg
| t | t at
at ta at
cg ta tg
gc gc at
at at cg
cg gc gt
ttctttaaaaattctttgaataaaatactatatgttagtagcttagtggggttaacttatgtgcttgagcatgatggcgcctttttgtctgtctaaatttcgtgttttagcaatcacttttttagttcttggtGTG
..................................................................................................................