                                                                        Gene putatively regulated by attenuation in C_pneumoniae_TW_183

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:137 nt.    Distance to gene:56 nt.     Distance to run of Ts=3 nt.   Size=26 nt.     Delta G= -7.80 kcal/mol
Antiterminator:    Distance from promoter:108 nt. Size=45 nt.     Delta G= -6.90 kcal/mol
Anti-antiterminator:    Distance from promoter:88 nt.    Size=32 nt.     Delta G=-11.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tcgatg-taaaat. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tcgatgctatttttccatggctatttttaaaatgatagccatggttatagatacgtagtccttatttcaaagaagacactgttgcattagatacgctctc
tgatccctcaaaatcacattttggtatctgattgctaagattgcaggataccacgcatcttaagagaaaggcgctcttacctagtagaggttgcgtgaat
ttcttgacttgtttctcctattggtgtatctcttaaaatattaaattcaaaatcaaagtatatattttacaATG

    CpB0017 --- CpB0018 Gene: CpB0017     GI: 33241352     BI number: CpB0017     GOG: -------     Description: to outer membrane protein 5 Gene: CpB0018     GI: 33241353     BI number: CpB0018     GOG: -------     Description: outer membrane protein            aa           t  g            ta            cg            ta           |  a   g       |  a a  a      a  g a  t       cg t  t       gc         t cg        cg       g  a gc       a  c      a  g ta       c  t       ta t  |      c  c       cg a  |      a  t       cg g  |      t  t       at tg       a  a      t  t cg        gc       t  | ta        gc       c  | at        at       t  | ta       |  a       cg gc        cg        gc gc        gt        cg ta        ta        gt                         gaatttcttgacttgtttctcctattggtgtatctcttaaaatattaaattcaaaatcaaagtatatattttacaATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_pneumoniae_TW_183                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:137 nt.    Distance to gene:65 nt.     Distance to run of Ts=3 nt.   Size=26 nt.     Delta G= -7.80 kcal/mol Antiterminator:    Distance from promoter:103 nt. Size=45 nt.     Delta G= -6.90 kcal/mol Anti-antiterminator:    Distance from promoter:88 nt.    Size=32 nt.     Delta G=-11.40 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: tcgatg-taaaat. It has a score value of 60.91 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case tcgatgctatttttccatggctatttttaaaatgatagccatggttatagatacgtagtccttatttcaaagaagacactgttgcattagatacgctctc tgatccctcaaaatcacattttggtatctgattgctaagattgcaggataccacgcatcttaagagaaaggcgctcttacctagtagaggttgcgtgaat ttcttgacttgtttctcctattggtgtatctcttaaaatattaaattcaaaatcaaagtatatattttacaATG     CpB0017 --- CpB0018 Gene: CpB0017     GI: 33241352     BI number: CpB0017     GOG: -------     Description: to outer membrane protein 5 Gene: CpB0018     GI: 33241353     BI number: CpB0018     GOG: -------     Description: outer membrane protein            at           c  c            gt            ct            aa           |  a   g       |  g a  a      c  a a  t       cg t  t       aa         t cg        ta       g  a gc       a  a      a  g ta       g  g       ta t  |      g  g       cg a  |      a  c       cg g  |      c  g       at tg       g  c      t  t cg        tt       t  | ta        tc       c  | at        at       t  | ta       |  t       cg gc        ga        gc gc        ac        cg ta        ac        gt                         gaatttcttgacttgtttctcctattggtgtatctcttaaaatattaaattcaaaatcaaagtatatattttacaATG     ..................................................................................................................