Gene putatively regulated by attenuation in C_pneumoniae_TW_183
Characteristics of the secondary structures
Terminator: Distance from promoter:85 nt. Distance to gene:46 nt. Distance to run of Ts=1 nt. Size=24 nt. Delta G=-11.10 kcal/mol
Antiterminator: Distance from promoter:23 nt. Size=75 nt. Delta G= -4.37 kcal/mol
Anti-antiterminator: Size=54 nt. Delta G= -7.00 kcal/mol
Nomenclature/Definitions
The most likely promoter is: ttaaat-tatatt. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
ttaaattctttgaataaaatactatatattagtggctgagttagtttaacttatgtgtttgattccgatagcaccacagattcataatgcaagtacctct
atcaccacagctacccccccccagaccactctgtaggggcttctttttgtctgtctaaatttcgtgttttagcaatcacttttttagttcttggtGTG
CpB0047
Gene: CpB0047 GI: 33241382 BI number: CpB0047 GOG: ------- Description: HB3/HB4 fusion protei
a
c a
g g
t t
a a
a c
t c
a t
ta c c
t t t t
cg ta
at at
a g gc
t t a a
t | c c
t | a c
gt c a
at c c
tg a a
ta cg
gt gc
at at
gc ta
| c | c
| g a c
| a g c
| t c c
ta c c ca
cg t c c c
gc t c at
| a a c gc
| c gc at
gc ta cg
ta tg c t
gc ta c a
a a gc cg
tg t | cg
ta gc cg
at ta cg
cttctttttgtctgtctaaatttcgtgttttagcaatcacttttttagttcttggtGTG
..................................................................................................................