                                                                        Gene putatively regulated by attenuation in C_pneumoniae_TW_183

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:106 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-13.70 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -5.46 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCTTCCTGAAGGAACTGAAATGGTAATGCCTGGAGATAACGTTGAGCTTGATGTTGAG
CTCATTGGAACAGTTGCTCTTGAAGAAGGAATGAGATTTGCAATTCGTGAAGGTGGTC
GTACTATCGGCGCTGGAACGATTTCAAAGATCAATGCTTAAaaatgaatttcgcgatgattttcatcatc
gcgattttctgGGTGTGTAGCTTAGCTGGTAGAGCAGTGGCCTCCAAAGCCGCCGGTCGGGG
GTTCGATTCCCTTCGCACCCGTagatttaatttttaatctagaagttggtttATG

    secE --- nusG Gene: secE     GI: 33241410     BI number: CpB0075     GOG: COG0690     Description: SecE Gene: nusG     GI: 33241411     BI number: CpB0076     GOG: COG0250     Description: transcription antitermination facto   t a  g a  a a  a A  t A  t T  t T  c       tt Cg       t  c Gc        ta Tg        at A  a       gc At        ta Cg        at Ta        gc At        cg Gt        gc At        cg At        ta             ttttctgGGTGTGTAGCTTAGCTGGTAGAGCAGTGGCCTCCAAAGCCGCCGGTCGGGGGTTCGATTCCCTTCGCACCCGTagatttaatttttaatctagaagttggtttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [U] COG0690 Preprotein translocase subunit SecE ... can be seen here [K] COG0250 Transcription antiterminator ... can be seen here     ..................................................................................................................