                                                                        Gene putatively regulated by attenuation in C_pneumoniae_TW_183

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:44 nt.     Distance to run of Ts=3 nt.   Size=36 nt.     Delta G=-18.90 kcal/mol
Antiterminator: Size=66 nt.     Delta G=-14.90 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G= -6.82 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGAGTCTTAACAGATGCAGCTTGTTGTAGCAAAACCGACTACCTTCTTGGATTTAAGG
AAAATGTGATCATGGGTCATATGATTCCTGGTGGTACAGGCTTTGAAACGCATAAGCG
TATTAAGCAGTATCTAGAAAAAGAACAAGAAGATCTCGTTTTTGATTTTGTTAGTGAA
ACAGAGTGTGTTTGTTAActaggtgacacagtcttttatcaaggaggttatgtttacaacctccttgataggaatgtttttttttgt
taacgttgcctagagatcaacagtgatgccaaggtgcctATG

    CpB0083 --- CpB0084 Gene: CpB0083     GI: 33241418     BI number: CpB0083     GOG: COG0176     Description: transaldolase Gene: CpB0084     GI: 33241419     BI number: CpB0084     GOG: NOG07058     Description: putative predied ferredoxi            Ac           A  t           T  a           T  g           G  g           T  t            Tg   T        Ta T  G       Gc T  T       Ta T  T       Gc A  A       Ta G  G      G  g T  T       At TG        Gc TA        At TA       C  |       tt TA       A  |      g  t GC        At       t  a |  A       At       a  c CG        Gt        ta TA        Ta        ta CG        Gt        gc T  T      A  c       gc A  G       Ta        at G  T       Ta        gc A  G      G  g       gc A  |       Tg        at GT        Ta        at AT        Tg        cg AT        Tg        ta CG        At        at AT        Gt        ta AT        Ta        tg                         gaatgtttttttttgttaacgttgcctagagatcaacagtgatgccaaggtgcctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG0176 Transaldolase ... can be seen here     ..................................................................................................................