Gene putatively regulated by attenuation in C_pneumoniae_TW_183

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:104 nt.    Distance to gene:88 nt.     Distance to run of Ts=0 nt.   Size=16 nt.     Delta G= -6.90 kcal/mol
Antiterminator:    Distance from promoter:79 nt. Size=35 nt.     Delta G= -5.40 kcal/mol
Anti-antiterminator:    Distance from promoter:49 nt.    Size=45 nt.     Delta G=-10.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgata-catgct. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgatatcttcaagataaatcccatgctctcctctaactctctaagaaaaaattcctataaacatagaattcaaaaaagaagaattgcctttctatgttt
gtttgaaagtaggccttcttctagatccaaagattccctattgggaatatttttctgaaaacgatacaatcttgtataaggtagagagctatgctatgtg
ctttgaatctatcttaatgtacaactaactacataattttctATG

    CpB0085


Gene: CpB0085     GI: 33241420     BI number: CpB0085     GOG: NOG05811     Description: hypothetical protei


  t
t  t
g  g
t  t
a  t
t  t
 cg
 ta         a
 ta       g  t
|  a      a  c
|  g      t  c
|  t      c  a
 ta        ta
 cg        ta
 cg        cg
 gc        ta
t  c      t  t
t  |      c  t       at
 at       c  c      t  t
 at        gc        cg
 gc        gc        cg
 at        at        cg
 at        ta        ta
 gc        gt        ta
 at        at        at
                        atttttctgaaaacgatacaatcttgtataaggtagagagctatgctatgtgctttgaatctatcttaatgtacaactaactacataattttctATG


    ..................................................................................................................