Gene putatively regulated by attenuation in C_pneumoniae_TW_183

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:206 nt.     Distance to run of Ts=3 nt.   Size=27 nt.     Delta G= -7.30 kcal/mol
Antiterminator: Size=12 nt.     Delta G= -3.60 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G= -5.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gtccaatgtaaacaattctagaagataagcatgtagaggttagcagggagtTTGTCAAGGACGAGAGTTCGAGTCTCTC
CACCTCCATTATTTAAAAAAATTATTTTAAAATGCTACTCATCCCCTCTTAACGAGGA
GAATCTGTCTTTTTTACCAAATTTAGACAATGTCTTCCTAAAGTCTTTAAAGAAATCA
AATATCCATTAAaaaacccttctagatttcatagaaatagaaaagaaagataagttgttttataattcttaatgaaaaaatttatttcatt
ataaggcgattcttATG

    CpB0108


Gene: CpB0108     GI: 33241443     BI number: CpB0108     GOG: NOG09581     Description: hypothetical protei


 gg
a  t
g  t
a  a
 tg
 gc
 ta
|  g
|  g
|  g
a  a
 cg
 gt                   G
 aT                 C  A
 aT                 T  G
 tG                 T  T
 aT                  GC
 gC                  AT
a  A                 GC
a  |                 AT
g  |       AG        GC
a  |      G  A      C  C
 tA        CG       A  A
 cG        AT        GC
 tG        GT        GC
 tA        GC        AT
                        CCATTATTTAAAAAAATTATTTTAAAATGCTACTCATCCCCTCTTAACGAGGAGAATCTGTCTTTTTTACCAAATTTAGACAATGTCTTCCTAAAGTCTTTAAAGAAATCAAATATCCATTAAaaaacccttctagatttcatagaaatagaaaagaaagataagttgttttataattcttaatgaaaaaatttatttcattataaggcgattcttATG


    ..................................................................................................................