Gene putatively regulated by attenuation in C_pneumoniae_TW_183

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:170 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-24.10 kcal/mol

                                                                        Nomenclature/Definitions

AAGAAGACGCACTACCTGCTGCTAAAGGAAAGAAAAAAGTTGTAACTAAGAAAAAGAA
ATAAaacttcttttagatttcccatttataaaacccattctcaggctctcaagcccgagaatgggtttttttgtgagggctttctctcttgcaatag
cttgtataatacgttatgctttcctaggtcacgataattttgaaatagataacgttagatgcctgtatcagtataccaaggtgttttagagaatttttta
tctgattccatttgatactgatttttcaccactttttagggattcATG

    CpB0114 --- CpB0115 --- ffh --- CpB0117 --- CpB0118 --- CpB0119 --- CpB0120


Gene: CpB0114     GI: 33241449     BI number: CpB0114     GOG: COG0216     Description: translation releasing factor RF-1
Gene: CpB0115     GI: 33241450     BI number: CpB0115     GOG: COG2890     Description: protoporphyrinogen oxidase
Gene: ffh     GI: 33241451     BI number: CpB0116     GOG: COG0541     Description: signal recognition particle chain
Gene: CpB0117     GI: 33241452     BI number: CpB0117     GOG: COG0228     Description: ribosomal protein S16
Gene: CpB0118     GI: 33241453     BI number: CpB0118     GOG: COG0336     Description: tRNA (guanine-N1-)-methyltransferase
Gene: CpB0119     GI: 33241454     BI number: CpB0119     GOG: COG0335     Description: ribosomal protein L19
Gene: CpB0120     GI: 33241455     BI number: CpB0120     GOG: COG0164     Description: ribonuclease H I


          tc
         c  a
          ta
          cg
          gc
          gc
         a  c
          cg
          ta
          cg
          ta
          ta
          at
          cg
          cg
          cg
          at
          at
          at
            ttttgtgagggctttctctcttgcaatagcttgtataatacgttatgctttcctaggtcacgataattttgaaatagataacgttagatgcctgtatcagtataccaaggtgttttagagaattttttatctgattccatttgatactgatttttcaccactttttagggattcATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[J] COG0216 Protein chain release factor A ... can be seen here
[J] COG2890 Methylase of polypeptide chain release factors ... can be seen here
[U] COG0541 Signal recognition particle GTPase ... can be seen here
[J] COG0228 Ribosomal protein S16 ... can be seen here
[J] COG0336 tRNA-(guanine-N1)-methyltransferase ... can be seen here
[J] COG0335 Ribosomal protein L19 ... can be seen here
[L] COG0164 Ribonuclease HII ... can be seen here

    ..................................................................................................................