                                                                        Gene putatively regulated by attenuation in C_pneumoniae_TW_183

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:180 nt.     Distance to run of Ts=2 nt.   Size=19 nt.     Delta G= -7.00 kcal/mol
Antiterminator: Size=34 nt.     Delta G= -8.40 kcal/mol
Anti-antiterminator:   Size=15 nt.     Delta G= -4.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGTTTGTTGCGACTTCCAATGGTATGATCATTTCGCCTCTAATGTCTTTAGGATGGA
TTTTTATTGCGACTCTCGCAGCTATAGGAAATGCGGGCGTACCCATGGGATGCTACTT
TCTTACTCTTTCTCTTCTCACATCTATGAATGTTCCTTTATCTATATTAGGTCTCATC
TTACCTTTTTATACTGTAATAGATATGATAGAAACTTCTCTTAATGTTTGGTCTGATT
GCTGCGTAGTCAGTTTAGCAAACTAAcaactctcaaaaaaactctcactataaaggagtgctttaaccATG

    CpB0299 Gene: CpB0299     GI: 33241633     BI number: CpB0299     GOG: COG0733     Description: sodium-dependent amino acid transporte             T           A  A            TG            CG           |  A           |  A           G  A            AT            CG            GC            CG        AT            TG       C  G   T        CG        CG C  C      T  |       CG A  T      C  |      A  | GC       A  |       TA CG        GC        GT GC        CG        CG TA        GT        GC TG        TA        GT                         ACTTTCTTACTCTTTCTCTTCTCACATCTATGAATGTTCCTTTATCTATATTAGGTCTCATCTTACCTTTTTATACTGTAATAGATATGATAGAAACTTCTCTTAATGTTTGGTCTGATTGCTGCGTAGTCAGTTTAGCAAACTAAcaactctcaaaaaaactctcactataaaggagtgctttaaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0733 Na+-dependent transporters of the SNF family ... can be seen here     ..................................................................................................................