                                                                        Gene putatively regulated by attenuation in C_pneumoniae_TW_183

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:93 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-17.80 kcal/mol

                                                                        Nomenclature/Definitions

CACAAAAACCATAAGCATACATCTAGTTGTAAACGTGTCTGTTCTTCAACAGCTACGA
GAAAGCATGGCTCTAAAAGCCGTGTTCGTACAGCTCATGGCTGGCGTCACCAACTGAT
CAAAATGATGTCTCGATAAtttgtgattttcgcattattgctcatgttaacgggaaagggaaacattgggtttccttcccgttttt
ctttttaaggttaaaaagctttatagagcgagatcttcaggcttcatgctgtacagttggtaggaaaatacgtatagtaggttcaggatactacttttTT
G

    CpB0395 --- CpB0394 Gene: CpB0395     GI: 33241728     BI number: CpB0395     GOG: COG1466     Description: hypothetical protein Gene: CpB0394     GI: 33241727     BI number: CpB0394     GOG: COG0313     Description: hypothetical protei            t          t  g          a  g           cg           at           at           at           gc           gc           gt          a  |          a  |           at           gc           gc           gc           cg           at           at             tttctttttaaggttaaaaagctttatagagcgagatcttcaggcttcatgctgtacagttggtaggaaaatacgtatagtaggttcaggatactacttttTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG1466 DNA polymerase III, delta subunit ... can be seen here [R] COG0313 Predicted methyltransferases ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_pneumoniae_TW_183                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:100 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-12.80 kcal/mol Antiterminator: Size=67 nt.     Delta G= -9.70 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CACAAAAACCATAAGCATACATCTAGTTGTAAACGTGTCTGTTCTTCAACAGCTACGA GAAAGCATGGCTCTAAAAGCCGTGTTCGTACAGCTCATGGCTGGCGTCACCAACTGAT CAAAATGATGTCTCGATAAtttgtgattttcgcattattgctcatgttaacgggaaagggaaacattgggtttccttcccgttttt ctttttaaggttaaaaagctttatagagcgagatcttcaggcttcatgctgtacagttggtaggaaaatacgtatagtaggttcaggatactacttttTT G     CpB0395 --- CpB0394 Gene: CpB0395     GI: 33241728     BI number: CpB0395     GOG: COG1466     Description: hypothetical protein Gene: CpB0394     GI: 33241727     BI number: CpB0394     GOG: COG0313     Description: hypothetical protei ta t  a gc tg ag c  g ta ca ga |  g |  g |  g t  a t  a aa tc ta at |  t cg g c t          t t       t  g t       a  g t        cg |         at a        at g        at t        gc |         gc |         gt |        a  | g       a  | t        at t  |       gc t        gc A        gc             gtttttctttttaaggttaaaaagctttatagagcgagatcttcaggcttcatgctgtacagttggtaggaaaatacgtatagtaggttcaggatactacttttTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG1466 DNA polymerase III, delta subunit ... can be seen here [R] COG0313 Predicted methyltransferases ... can be seen here     ..................................................................................................................