Gene putatively regulated by attenuation in C_pneumoniae_TW_183

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:93 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-17.80 kcal/mol

                                                                        Nomenclature/Definitions

CACAAAAACCATAAGCATACATCTAGTTGTAAACGTGTCTGTTCTTCAACAGCTACGA
GAAAGCATGGCTCTAAAAGCCGTGTTCGTACAGCTCATGGCTGGCGTCACCAACTGAT
CAAAATGATGTCTCGATAAtttgtgattttcgcattattgctcatgttaacgggaaagggaaacattgggtttccttcccgttttt
ctttttaaggttaaaaagctttatagagcgagatcttcaggcttcatgctgtacagttggtaggaaaatacgtatagtaggttcaggatactacttttTT
G

    CpB0395 --- CpB0394


Gene: CpB0395     GI: 33241728     BI number: CpB0395     GOG: COG1466     Description: hypothetical protein
Gene: CpB0394     GI: 33241727     BI number: CpB0394     GOG: COG0313     Description: hypothetical protei


           t
         t  g
         a  g
          cg
          at
          at
          at
          gc
          gc
          gt
         a  |
         a  |
          at
          gc
          gc
          gc
          cg
          at
          at
            tttctttttaaggttaaaaagctttatagagcgagatcttcaggcttcatgctgtacagttggtaggaaaatacgtatagtaggttcaggatactacttttTTG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[L] COG1466 DNA polymerase III, delta subunit ... can be seen here
[R] COG0313 Predicted methyltransferases ... can be seen here

    ..................................................................................................................


                                                                        Gene putatively regulated by attenuation in C_pneumoniae_TW_183

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:100 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-12.80 kcal/mol
Antiterminator: Size=67 nt.     Delta G= -9.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CACAAAAACCATAAGCATACATCTAGTTGTAAACGTGTCTGTTCTTCAACAGCTACGA
GAAAGCATGGCTCTAAAAGCCGTGTTCGTACAGCTCATGGCTGGCGTCACCAACTGAT
CAAAATGATGTCTCGATAAtttgtgattttcgcattattgctcatgttaacgggaaagggaaacattgggtttccttcccgttttt
ctttttaaggttaaaaagctttatagagcgagatcttcaggcttcatgctgtacagttggtaggaaaatacgtatagtaggttcaggatactacttttTT
G

    CpB0395 --- CpB0394


Gene: CpB0395     GI: 33241728     BI number: CpB0395     GOG: COG1466     Description: hypothetical protein
Gene: CpB0394     GI: 33241727     BI number: CpB0394     GOG: COG0313     Description: hypothetical protei


 ta
t  a
 gc
 tg
 ag
c  g
 ta
 ca
 ga
|  g
|  g
|  g
t  a
t  a
 aa
 tc
 ta
 at
|  t
 cg
 g
 c
t          t
 t       t  g
 t       a  g
 t        cg
|         at
 a        at
 g        at
 t        gc
|         gc
|         gt
|        a  |
 g       a  |
 t        at
t  |       gc
 t        gc
 A        gc
            gtttttctttttaaggttaaaaagctttatagagcgagatcttcaggcttcatgctgtacagttggtaggaaaatacgtatagtaggttcaggatactacttttTTG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[L] COG1466 DNA polymerase III, delta subunit ... can be seen here
[R] COG0313 Predicted methyltransferases ... can be seen here

    ..................................................................................................................