                                                                        Gene putatively regulated by attenuation in C_pneumoniae_TW_183

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:144 nt.     Distance to run of Ts=2 nt.   Size=18 nt.     Delta G= -7.30 kcal/mol
Antiterminator: Size=25 nt.     Delta G= -5.70 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G= -6.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TATAGTCATCCTCCCAGAGGATGCTAGGTTGTTGTTTTGTTGAGGGGATCAGAGATAG
GGAAACACGGTCGCCAGGTTGTACCTTGTAGGATTCAAATCTTTCTATGAACCCGTTC
ACTCGACATCGATGTTGGCGAATAGACGCCAAGATTTCTTGCTTGCTATGATTAGGCA
GTTGAGATCTAAGAAAAGAAGATAATCTTGAGACTTGTGTGGCAAGCCAGGAAAAATT
TTCCATAAAATATTGTAAAGCAGCCCTTTTATCATTTGATAATTGCATaaaattttaagagatt
ttgtATG

    CpB0415 --- CpB0414 Gene: CpB0415     GI: 33241748     BI number: CpB0415     GOG: COG1194     Description: A/G-specific adenine glycosylase Gene: CpB0414     GI: 33241747     BI number: CpB0414     GOG: COG1694     Description: beta-lactamase regulatory protein homolo   A A  A C  T T  C T  T AT GT GC AT TA GT TG TA |  A |  C |  C C  C CG AT T  T       CA GC       A  T TA        GC T  |       CG GC        TA        TA GT       |  T      A  G A  |       CG       A  A C  |       AT        GC C  |      C  T       CG GC       T  G       GC CG        TG        GC TA        GC        TA GC        CG        TA                         GATTTCTTGCTTGCTATGATTAGGCAGTTGAGATCTAAGAAAAGAAGATAATCTTGAGACTTGTGTGGCAAGCCAGGAAAAATTTTCCATAAAATATTGTAAAGCAGCCCTTTTATCATTTGATAATTGCATaaaattttaagagattttgtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG1194 A/G-specific DNA glycosylase ... can be seen here [R] COG1694 Predicted pyrophosphatase ... can be seen here     ..................................................................................................................