                                                                        Gene putatively regulated by attenuation in C_pneumoniae_TW_183

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:61 nt.    Distance to gene:27 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-12.90 kcal/mol
Antiterminator:    Distance from promoter:47 nt. Size=25 nt.     Delta G= -3.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttctct-tataac. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttctctcccaagattgaaacttctataactgagagtcttctccagagcatttacttgatttatttaactgtattctctattggtgcaccatgctcctaaa
gccacatgctatgggagtatttttgataaaaagcttttccccaaagacacATG

    CpB0460 Gene: CpB0460     GI: 33241793     BI number: CpB0460     GOG: -------     Description: Omp1             c           a  a   c       c  t c  a       cg a  t       gc cg        at gc       a  a t  t       at gc        tg gc        cg t  t       cg t  a       ta a  a       cg ta        gt cg        ta             tttttgataaaaagcttttccccaaagacacATG     ..................................................................................................................