                                                                        Gene putatively regulated by attenuation in C_pneumoniae_TW_183

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:182 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G= -7.90 kcal/mol
Antiterminator: Size=48 nt.     Delta G= -5.30 kcal/mol
Anti-antiterminator:   Size=39 nt.     Delta G= -8.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

attgaataagataattcactatttttagatcctaaattttaagtggtttttgttatgcttcttatagagaatagctgcaaagattagagTTGCAGA
GACGGTACGTCTCTTTCTTTTTTAAGGGAAGGGGTGTTGTTACACCCATCCTAAGATT
TGTGAGATTCCCCTCAGGCAGTAACTTTTACAATCGTACTTTATGTTTTGATCTAGCT
GTTTTCTTGTCTTTAATTTATTCAACCATCGAGAAGAGAGATCCATGAgtggaaatgtatttta
ttaggatcatctctaaggatggaaATG

    CpB0465 Gene: CpB0465     GI: 33241798     BI number: CpB0465     GOG: COG0620     Description: hypothetical protei             t           t  a           a  g           g  a           a  g            aT            aT            cG            gC   t        tA a  a       cG tg       g  | ta       a  | cg       t  | ta       a  |        T |  a      a  |      G  A |  t      g  |       GC ta       a  |       CG cg       g  |       AT gc       a  |       GC t  t      t  |       AT a  |      a  |       GC t  |      t  |       AT tg        tA       C  | gc        cG       G  | ta        tA       T  | ta       |  C      T  | ta        tG        gT tg        cG        aT ta        gT        gC gt        tA        aT                         TTTTTAAGGGAAGGGGTGTTGTTACACCCATCCTAAGATTTGTGAGATTCCCCTCAGGCAGTAACTTTTACAATCGTACTTTATGTTTTGATCTAGCTGTTTTCTTGTCTTTAATTTATTCAACCATCGAGAAGAGAGATCCATGAgtggaaatgtattttattaggatcatctctaaggatggaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0620 Methionine synthase II (cobalamin-independent) ... can be seen here     ..................................................................................................................