                                                                        Gene putatively regulated by attenuation in C_pneumoniae_TW_183

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:143 nt.    Distance to gene:39 nt.     Distance to run of Ts=1 nt.   Size=25 nt.     Delta G=-10.70 kcal/mol
Antiterminator:    Distance from promoter:126 nt. Size=31 nt.     Delta G= -5.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tagatt-tatagt. It has a score value of 70.95 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tagattttttgtctataatttgttttatagtgtctaattatgagtagtttaaagttatcttatttaagacaagacgattttaatttccttttttcacaat
aaaatgcgagtccaagagttttagtaaacgtacatcatactttggaaaatggcagcaagtagtcagaggatcaagctctttgcatactttgcttagagca
gtttttggttctcagggtcgtttgcctttagggagcttgtgatgtTTG

    CpB0483 --- CpB0482 --- CpB0481 --- CpB0480 Gene: CpB0483     GI: 33241816     BI number: CpB0483     GOG: -------     Description: hypothetical protein Gene: CpB0482     GI: 33241815     BI number: CpB0482     GOG: -------     Description: hypothetical protein Gene: CpB0481     GI: 33241814     BI number: CpB0481     GOG: -------     Description: hypothetical protein Gene: CpB0480     GI: 33241813     BI number: CpB0480     GOG: -------     Description: hypothetical protei   a c  a t  g a  c        c gt       a  t gc       t  t at        at gt        cg at        gc cg       t  t t  c      t  t g  a       ta at        cg ta        ta gc        cg at        gc             agtttttggttctcagggtcgtttgcctttagggagcttgtgatgtTTG     ..................................................................................................................