                                                                        Gene putatively regulated by attenuation in C_pneumoniae_TW_183

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:172 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-17.80 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -4.00 kcal/mol
Anti-antiterminator:   Size=58 nt.     Delta G=-13.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gacgaatcttcagatagcgacactcaaactgaaaaagatgaagaaggcggttctgaagagaatactgctgaatagtttttagtttttaaaagacaaacaa
gagggtgaaagccctctatttgtctttttcccccatgagttgacaagttatttccatactcacaactctcttatattaaaattttggagattgtttttgt
tctatgtagcgacaaataatttctaaaagagtctttgctccttatccctctcttctgaaatttcttgacccattcatagtccaaagcataacatggttac
ATG

    CpB0624 --- CpB0623 --- dppB --- CpB0621 Gene: CpB0624     GI: 33241955     BI number: CpB0624     GOG: -------     Description: hypothetical protein Gene: CpB0623     GI: 33241954     BI number: CpB0623     GOG: -------     Description: oligopeptide ABC transporter Gene: dppB     GI: 33241953     BI number: CpB0622     GOG: COG0601     Description: dipeptide transport system permease protein Gene: CpB0621     GI: 33241952     BI number: CpB0621     GOG: COG1173     Description: oligopeptide ABC transporter permease protei aa g  g ta cg ta |  a |  t ta gc gt        tt cg       t  t gc       g  t gt       a  a a  g       ta a  a       ta g  |       ta        aa a  |       tg       g  a a  |       ta        tg g  |       gc        gc ta       a  a       gc at       t  a       gc g  a      a  a       at a  g      a  c       gc at       g  a       at at        ta       a  a at        cg       c  | at       |  a       at gt       g  g       at ta        tg        at cg        cg        cg at        at        at at        tg        gc                         tttttcccccatgagttgacaagttatttccatactcacaactctcttatattaaaattttggagattgtttttgttctatgtagcgacaaataatttctaaaagagtctttgctccttatccctctcttctgaaatttcttgacccattcatagtccaaagcataacatggttacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [EP] COG0601 ABC-type dipeptide/oligopeptide/nickel transport systems, permease components ... can be seen here [EP] COG1173 ABC-type dipeptide/oligopeptide/nickel transport systems, permease components ... can be seen here     ..................................................................................................................