                                                                        Gene putatively regulated by attenuation in C_pneumoniae_TW_183

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:211 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-16.60 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -9.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACCTTCCAAAGCACGCGGATTTAGAAAATAAttcgccttagcttgatttcgtTTAGAGGGTGGGTAA
TTTTCTACTCATCCTCTTTTTTATGCCCAAATTTTTCTCTGTGCTACCTAGGAGTTCT
TCCTTAAAAAGGTAGAGATATAATTTTCCTTCGTGATAAAATTTCCATTTTGCTTTTG
ATATTCTCAAACAACCTTTCAAGTATCTCATctagggattcgaaatgaaggtccttgtgaattgttgtctagttctc
agattacctctctaacaaaaactaagcttctatcttaactATG

    CpB0914 Gene: CpB0914     GI: 33242245     BI number: CpB0914     GOG: COG2265     Description: protein Hom tt a  t gc tg |  t t  T c  T g  A a  G       TT tA       T  T tG       A  C cG        AT cG        TA gT        GC cG        GT tG        GC tG        TA AT        GT A  A       GC TA        GC AT        AT AT        GC AT        AT             TTTTTATGCCCAAATTTTTCTCTGTGCTACCTAGGAGTTCTTCCTTAAAAAGGTAGAGATATAATTTTCCTTCGTGATAAAATTTCCATTTTGCTTTTGATATTCTCAAACAACCTTTCAAGTATCTCATctagggattcgaaatgaaggtccttgtgaattgttgtctagttctcagattacctctctaacaaaaactaagcttctatcttaactATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG2265 SAM-dependent methyltransferases related to tRNA (uracil-5-)-methyltransferase ... can be seen here     ..................................................................................................................