Gene putatively regulated by attenuation in C_pneumoniae_TW_183

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:196 nt.     Distance to run of Ts=2 nt.   Size=31 nt.     Delta G= -8.90 kcal/mol
Antiterminator: Size=38 nt.     Delta G= -4.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTTATAGAGTCTGTGCGTACTCTTTGAGCTGCTGCCTTGTTTCCTTTCTCTGCTTTA
GCTAAGTCGTGTTGGATGCTATCCAGCAGGTCTTTCATtttttttgccgtatcttttagcgccatgaaaagc
gtcctctagtcgctgttttaaactatttttacttgttttaatttttaattagtttgtttgttcaaattcatgcaaccattttttagagaaaataagactt
ttgtaagttattgttattttgttatgagaacacacttctttgtttatcaatgtgttaatttataaaatgtTTG

    CpB0917 --- CpB0919


Gene: CpB0917     GI: 33242248     BI number: CpB0917     GOG: -------     Description: hypothetical protein
Gene: CpB0919     GI: 33242249     BI number: CpB0919     GOG: NOG04853     Description: putative chltr phosphoprotei


 TT
T  A
 CG
 GC
T  T        C
C  A      G  T
 TA        TA
 CG        AT
|  T       GC
|  C       GC
|  G       TA
|  T       TG
T  G       GC
T  T       TA
T  T      G  |
 CG        CG
 CG        TG
 TA       |  T
T  T       GC
 TG        AT
 GC        AT
            TCATtttttttgccgtatcttttagcgccatgaaaagcgtcctctagtcgctgttttaaactatttttacttgttttaatttttaattagtttgtttgttcaaattcatgcaaccattttttagagaaaataagacttttgtaagttattgttattttgttatgagaacacacttctttgtttatcaatgtgttaatttataaaatgtTTG


    ..................................................................................................................