                                                                        Gene putatively regulated by attenuation in C_pneumoniae_TW_183

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:172 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G= -6.30 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -4.40 kcal/mol
Anti-antiterminator:   Size=78 nt.     Delta G=-14.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCTCGGCCTTACCGCTTGGCTATGCCACCAaaggggaggATGAGAATCCTTAGTGTAAGCG
AAAGAAGATTTTATGGTAAGCGAGAAGTGCGCATAATTCTAGAGACTAGGGAAATCTT
AGTCGTTTTTGAGAGATGCAATTGCATTTTAGTTCTCTTAAAAAAGAGGTTATGTAAT
CAACCTAATAAGGGTACTTGCATTCTTGTCTGCATTTTAAATATAGTACTTTTTAGTG
TAGGTCCATCCTTCTGGTAGggagttcagactttctaaaaccatagatgctgtaggcaaaattatATG

    CpB0931 --- CpB0932 --- CpB0933 --- lytE --- CpB0935 --- CpB0936 --- CpB0937 Gene: CpB0931     GI: 33242262     BI number: CpB0931     GOG: COG0770     Description: UDP-N-acetylmuramoylalanyl-D-glutamyl-2, 6-diaminopimelate--D-alanyl-D-alanine ligase Gene: CpB0932     GI: 33242263     BI number: CpB0932     GOG: COG0472     Description: phospho-N-acetylmuramoyl-pentapeptide- transferase Gene: CpB0933     GI: 33242264     BI number: CpB0933     GOG: COG0771     Description: UDP-N-acetylmuramoylalanine--D-glutamate ligase Gene: lytE     GI: 33242265     BI number: CpB0934     GOG: COG1388     Description: cell wall hydrolase Gene: CpB0935     GI: 33242266     BI number: CpB0935     GOG: COG0772     Description: stage V sporulation protein E Gene: CpB0936     GI: 33242267     BI number: CpB0936     GOG: COG0707     Description: UDP-N-acetylglucosamine--N-acetylmuramyl- pentapeptide Gene: CpB0937     GI: 33242268     BI number: CpB0937     GOG: COG0773     Description: UDP-N-acetylmuramate--alanine ligas AG G  A TA AT gC gC aT gT |  A |  G |  T |  G |  T |  A |  A |  G |  C |  G |  A |  A |  A |  G |  A g  A g  G g  A       GC aT       C  A aT       G  T AT       T  A C  T      G  A C  A       AT AT        AT CG        GC CG        AT GT       G  A TA       C  G A  |      G  A TA       A  G CG       A  |        A GC        TA       A  A |  G       GC       G  T |  A       GT        GC G  G       TA        GT TA       A  G       AT TA       T  G       TA CG        TG        CG GT        TA        AT CG        TA        GC                         GTTTTTGAGAGATGCAATTGCATTTTAGTTCTCTTAAAAAAGAGGTTATGTAATCAACCTAATAAGGGTACTTGCATTCTTGTCTGCATTTTAAATATAGTACTTTTTAGTGTAGGTCCATCCTTCTGGTAGggagttcagactttctaaaaccatagatgctgtaggcaaaattatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG0770 UDP-N-acetylmuramyl pentapeptide synthase ... can be seen here [M] COG0472 UDP-N-acetylmuramyl pentapeptide phosphotransferase/UDP-N-acetylglucosamine-1-phosphate transferase ... can be seen here [M] COG0771 UDP-N-acetylmuramoylalanine-D-glutamate ligase ... can be seen here [M] COG1388 FOG: LysM repeat ... can be seen here [D] COG0772 Bacterial cell division membrane protein ... can be seen here [M] COG0707 UDP-N-acetylglucosamine:LPS N-acetylglucosamine transferase ... can be seen here [M] COG0773 UDP-N-acetylmuramate-alanine ligase ... can be seen here     ..................................................................................................................