                                                                        Gene putatively regulated by attenuation in C_pneumoniae_TW_183

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:90 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-17.80 kcal/mol
Antiterminator: Size=32 nt.     Delta G= -6.70 kcal/mol
Anti-antiterminator:   Size=77 nt.     Delta G=-19.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCGTCGTTTAGAGAGAATTGGGTTGAAGCCTATCTATCACTCCAGAAATCCTTTCCCT
TGGATGAGCGAAACCATGGATCTGAATAAAGAAAAGAATTTCTTTGAAACCCGGGTTA
CCGAATACCAAACCGCTGGTAATTTAAGTTGGTAAtttcacctctttttcaagggagttttgagagatggtctt
agatcgtctctcaggatttttcagctttcccttccgaagaaagtccttagaaaaaacttcaagaagctttatactttcctaaagcaaacagtctctgatt
tctgctttttATG

    CpB1023 Gene: CpB1023     GI: 33242354     BI number: CpB1023     GOG: COG0220     Description: putative rRNA methylas CC A  G A  C AT CG CG AT TA |  A |  T |  T |  T |  A |  A A  G AT GT CG CG AT TA |  A |  t |  t |  t |  c Ta Gc         a         t Gc       g  g      t  a Gt       g  t       cg C  c       gt        ta C  t       at        gt C  t       at        gc At        cg        tg At        ta        at At        tg        gc Gc        ta        at Ta        tg        gc Ta        ta        at Tg       c  t       gc Cg       t  |       ta Tg        cg        tg Ta        cg        tg Tg        at        ta                         tttttcagctttcccttccgaagaaagtccttagaaaaaacttcaagaagctttatactttcctaaagcaaacagtctctgatttctgctttttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0220 Predicted S-adenosylmethionine-dependent methyltransferase ... can be seen here     ..................................................................................................................