Gene putatively regulated by attenuation in C_pneumoniae_TW_183

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:203 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G= -8.40 kcal/mol
Antiterminator: Size=60 nt.     Delta G=-14.42 kcal/mol
Anti-antiterminator:   Size=26 nt.     Delta G= -6.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tgaggccccagaggagaaaccgagtttgctggataaagcgcgttctttatttactcgcgaggaccatacctagcataactccaagagttgtgtttcttta
aaaattctttgaataaaatactatatgttagtagcttagtgggtttaacttatgtgtttgagcatgatggcgccacagattcataatgcaagtacctcta
tcaccacagctacccccccccccccccagaccactctgtaggggcttttttttgtctgtctaaatttcgtgttttagcaatcacttttttagttcttggt
GTG

    CpB1097 --- CpB1098


Gene: CpB1097     GI: 33242427     BI number: CpB1097     GOG: -------     Description: Hb4
Gene: CpB1098     GI: 33242428     BI number: CpB1098     GOG: -------     Description: pHB5 protei


            a
          t  t
          t  t
          t  t
          c  a
          t  c
          t  t
           gc
           cg
           gc
           cg
          |  a
          |  g
          |  g
          |  a
          g  c
          a  c
          a  a
           at
           ta
 at       a  c
g  a       gc
g  a       gt         a
 ta        ta       c  a
 cg        cg        cg
 gc        gc        ta
 tg        ta        cg
t  c      |  t       at
t  g       ta        at
 gt        ta        tg
 at        gc        at
 gc        at        cg
 Gt        gc        gt
                        ttctttaaaaattctttgaataaaatactatatgttagtagcttagtgggtttaacttatgtgtttgagcatgatggcgccacagattcataatgcaagtacctctatcaccacagctacccccccccccccccagaccactctgtaggggcttttttttgtctgtctaaatttcgtgttttagcaatcacttttttagttcttggtGTG


    ..................................................................................................................