Gene putatively regulated by attenuation in C_pneumoniae_TW_183

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:130 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-10.50 kcal/mol
Antiterminator: Size=50 nt.     Delta G=-15.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAATGGTCACTTACTGCAGAAGCTCGTTTAATTAACGAGAGAGCTGCTCACGTATCTG
GTCAGTTCAGATTCTAAagatttgcttagaatttctcctcaccttgttatcagagtctacatgttaggctctgatttatgctcagagc
ttcttaatttctgagcaatttttattccccccctacttcacatcacatcaagacaaatgaattatttacttatgctattttctaatagcttcctgtagat
tacacgcttgcgttaaaagcattattacactactataccccttaatccagtttgCGC

    _v23


Gene: _v23     GI: _v23     BI number: _v23     GOG: -------     Description: tRNA-Gl



  t
a  g
c  t
 at
 ta
 cg
 tg
 gc
 at
 gc
 at
 cg
 ta
 at
|  t        t
|  t      c  t
|  a      t  a
t  t      t  a
 tg       c  t
 gc        gt
t  t       at
t  c       gc
c  a       at
c  |       cg
a  |       ta
 cg        cg
 ta        gc
 cg        ta
            atttttattccccccctacttcacatcacatcaagacaaatgaattatttacttatgctattttctaatagcttcctgtagattacacgcttgcgttaaaagcattattacactactataccccttaatccagtttgCGC


    ..................................................................................................................