                                                                        Gene putatively regulated by attenuation in C_pneumoniae_TW_183

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:3 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-13.70 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -5.46 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTACGTTCTTCAGAAAGAAGAAGGCGGACGTCATAAGCCTTTCTTCAGCGGATACAG
ACCTCAGTTCTTCTTCCGTACTACAGACGTGACAGGAGTCGTAACTCTTCCTGAAGGA
ACTGAAATGGTAATGCCTGGAGATAACGTTGAGCTTGATGTTGAGCTCATTGGAACAG
TTGCTCTTGAAGAAGGAATGAGATTTGCAATTCGTGAAGGTGGTCGTACTATCGGCGC
TGGAACGATTTCAAAGATCAATGCTTAAaaatgaatttcgcgatgattttcatcatcgcgattttctgGGT

    _v3 Gene: _v3     GI: lcl88493_88565     BI number: lcl88493_88565     GOG: -------     Description: tRNA-Tr   t a  g a  a a  a A  t A  t T  t T  c       tt Cg       t  c Gc        ta Tg        at A  a       gc At        ta Cg        at Ta        gc At        cg Gt        gc At        cg At        ta             ttttctgGGT     ..................................................................................................................