                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:6 nt.     Distance to run of Ts=1 nt.   Size=24 nt.     Delta G= -9.80 kcal/mol
Antiterminator: Size=30 nt.     Delta G= -6.50 kcal/mol
Anti-antiterminator:   Size=24 nt.     Delta G= -5.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGCTTGAAATGCTCAGGCATTCACTGGTCGCTCAACCAGCTTGAttccgtagccttctgttcaaaaa
aagcctgccgttgagcgggctttttttgcatcggtgaaaaagattatattgtccgcacgcgaaatagctgtaacttgtttttcttttttGGGGCTT
TAGCTCAGTTGGTAGAGCGTCTCGTTCGCAATGAGAAGGTCAGGGGTTCGACTCCCCT
AAGCTCCACAAaaccctgcaggtctcatcccgattgcggaaatcgtgacccgaaagcagggcgcggcgtttttccctggATG

    CT0017 --- nadD Gene: CT0017     GI: 21672858     BI number: CT0017     GOG: -------     Description: hypothetical protein Gene: nadD     GI: 21672857     BI number: CT0016     GOG: COG1057     Description: nicotinate-nucleotide adenyltransferase, putativ             g           c  g           g  a            ta            ta   t        at         a a  c       gc       a  g c  c       cg       a  c t  c      c  t      g  a cg       c  |       cg ta       t  |       cg g  |      a  |       cg gt       c  |      a  | at       t  |       gc cg        cg        tg gc        ta        gc tg        gc        cg cg        gc        tg                         cgtttttccctggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG1057 Nicotinic acid mononucleotide adenylyltransferase ... can be seen here     ..................................................................................................................