                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:204 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-19.50 kcal/mol
Antiterminator: Size=39 nt.     Delta G= -9.90 kcal/mol
Anti-antiterminator:   Size=41 nt.     Delta G= -8.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCACAACATCATGCTTGGCCTCAGGTATCAGTTCTGAtttacggctgaaacattagcgcgaatcaaaaccgga
agccatggcttccggtttttttattgccccgccctccgcttcacgccatcgcgtcctgaacgagcagtattcagagcgccttcaaccgctTTACTG
CTTGCCTGAAATGCTTATATTGTTCCCCTGTCTCAAATCGATCCTCGACCGCTGCATG
AGTTGCGCCAGCGCCTGGTGGCGGCCGGTTTTCATCATctaacaaaagacgccgctcaggcaatgcttggtt
cATG

    CT0070 --- CT0071 --- CT0072 Gene: CT0070     GI: 21672911     BI number: CT0070     GOG: COG0075     Description: aminotransferase, class V Gene: CT0071     GI: 21672912     BI number: CT0071     GOG: -------     Description: hypothetical protein Gene: CT0072     GI: 21672913     BI number: CT0072     GOG: COG1032     Description: BchE/P-methylase family protei   g t  g t  t c  t       ac gc       a  a tA        at aT        gt a  G       ta cG        cg gT       g  |       at |  T       gc       c  g gC        cg        cg aT       a  c       gc cG       t  g       at tA        ta        at |  t       ta        gc |  t       At        gc |  t       Gc        cg c  a       Ta        cg gc       C  a       at cg        Ta        at cg        Ta        at gc        Gc        at                         tttattgccccgccctccgcttcacgccatcgcgtcctgaacgagcagtattcagagcgccttcaaccgctTTACTGCTTGCCTGAAATGCTTATATTGTTCCCCTGTCTCAAATCGATCCTCGACCGCTGCATGAGTTGCGCCAGCGCCTGGTGGCGGCCGGTTTTCATCATctaacaaaagacgccgctcaggcaatgcttggttcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0075 Serine-pyruvate aminotransferase/archaeal aspartate aminotransferase ... can be seen here [C] COG1032 Fe-S oxidoreductase ... can be seen here     ..................................................................................................................