                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:104 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-12.10 kcal/mol
Antiterminator: Size=32 nt.     Delta G= -7.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCTCAGGGCATGAACACCCTGGTCTCGAAATCGATCAAGGGCTACAAAGGCACCAAAG
GCATGATGCCTGCCAAGGGTGGCAACGCAAAACTGACCGACGCACAGGTCGGCAACGC
CGTTGCTTACATGGTTGGCCAGAGCAAATAAgttctctttgcataccagcggaaaacgggagccagcctcccgtttt
ttgttgcccaccgatcctccgattcactcccgccggtgatccgatattttcttatctttgcctgtagatcgtcgagcgaggaatcatcacaacgactgga
attacccATG

    CT0076 --- proC --- CT0078 Gene: CT0076     GI: 21672917     BI number: CT0076     GOG: COG4095     Description: conserved hypothetical protein Gene: proC     GI: 21672918     BI number: CT0077     GOG: COG0345     Description: pyrroline-5-carboxylate reductase Gene: CT0078     GI: 21672919     BI number: CT0078     GOG: NOG39935     Description: hypothetical protei ac t  c a  a cg gc tg tg         a ta       c  g |  a      c  c |  a       gc |  a       at |  c       gc cg        gc tg        gc cg        cg ta        at tg        at gc        at             tttgttgcccaccgatcctccgattcactcccgccggtgatccgatattttcttatctttgcctgtagatcgtcgagcgaggaatcatcacaacgactggaattacccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4095 Uncharacterized conserved protein ... can be seen here [E] COG0345 Pyrroline-5-carboxylate reductase ... can be seen here     ..................................................................................................................