                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:89 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-17.20 kcal/mol
Antiterminator: Size=29 nt.     Delta G= -6.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGCACCATCATGCTAACCGGAATTCTTACCCTCTGGGGCTGGATCCCCGGTGTGGTG
GCAGCCCTTATCATGATCTCGAAAGAGCAGTCCGGCAAAACTGCGGAAGCGTAAagttct
ttcgaacttccagtaagtacactggccactccataagagttcctcactggcccggcattttctgaaaaaaaagaaatccgggccgggtgtttttaccaat
gttcagagcacatcgactcctgatccatacagcgtctgaacctttcagttcagacgctgcagaggctcaaccagcgacaaccATG

    CT0082 Gene: CT0082     GI: 21672923     BI number: CT0082     GOG: COG0816     Description: conserved hypothetical protei            aa           a  a   t       a  a a  a      g  a c  a       ta cg        cg ta        ta cg        ta at        ta |  t      |  t |  c      |  c |  c      |  c |  t      t  g |  c      a  g |  a       cg |  c       gc |  t       gc cg        cg cg        cg gc        cg gc        gt             gtttttaccaatgttcagagcacatcgactcctgatccatacagcgtctgaacctttcagttcagacgctgcagaggctcaaccagcgacaaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0816 Predicted endonuclease involved in recombination (possible Holliday junction resolvase in Mycoplasmas and B. subtilis) ... can be seen here     ..................................................................................................................