                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:183 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-17.40 kcal/mol
Antiterminator: Size=35 nt.     Delta G= -7.90 kcal/mol
Anti-antiterminator:   Size=31 nt.     Delta G= -6.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCTGTAACGTCGATCGTCCTCGCAACCTCGCCAAGTCGGTGACGGTGGAGTAGcgattttt
ttctcgattcagctccttcccttttgctgcgtcagacaggcgaaaggggggctttttaccttgatagaccctccaaaaaaagataaagagcagttcgcca
tgctttttcgttttgcagtctggtgacaagccttcggggcgtagcagtttacagcaacagaggctttcgggaattatttcttcacctcttccggttatct
gtcgaacagtaacacctacctaattcaaaccgcagactcATG

    CT0131 Gene: CT0131     GI: 21672972     BI number: CT0131     GOG: COG1090     Description: conserved hypothetical protei                       a            cc       c  g tt       t  c       ta t  t      t  t       gc t  t      c  t      c  a t  c      c  t      g  | at       t  t       tg gc        cg        cg cg        gc        gc |  a       at        tg |  t       cg        ta |  t      t  c       ta G  c       tg        ta A  a       at        cg Tg        gc        cg Gc       c  |       cg At        ta        tg Gc        cg        tg Gc        ta        cg                         ctttttaccttgatagaccctccaaaaaaagataaagagcagttcgccatgctttttcgttttgcagtctggtgacaagccttcggggcgtagcagtttacagcaacagaggctttcgggaattatttcttcacctcttccggttatctgtcgaacagtaacacctacctaattcaaaccgcagactcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1090 Predicted nucleoside-diphosphate sugar epimerase ... can be seen here     ..................................................................................................................