                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:149 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-18.80 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -9.00 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-14.02 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCAAGATATTTATCACTCCTTTGGAGGAGTGCGTGAGGATCAGAACCAACGAACGAG
GAGGTAGCGCTATCTGAttgataccgcttttgttatctgttcgctaagcgaaaagaaaatgccgcaaaggagaaatccctgcggcgtt
ttcttttcataccgattctttatttcatctgtttccagccgggcgtggtggcgtcgagccagcgctcggcatccggatcgccacgccgggcggcctgcct
gaaatcatcgaaagcgccggtgctgtcaccggttttgattcgggcgatggcgcgATG

    CT0134 Gene: CT0135     GI: 21672976     BI number: CT0135     GOG: -------     Description: hypothetical protei   A G  t T  t        a Cg       t  a Ta        cg At        gc Ta        cg C  c       ta Gc        ta Cg       g  a Gc        ta        aa At        cg       g  a |  t       ta        at T  t      |  a       gc G  t      |  a       gc G  g      |  a      a  c A  t      |  t      a  | G  t      |  g       at G  a      a  c       cg At       t  c       gc Gc        tg        cg |  t       gc        cg Cg        ta        gc At        ta        tg At        ta        at Gc        tg        at Cg        cg        at                         tcttttcataccgattctttatttcatctgtttccagccgggcgtggtggcgtcgagccagcgctcggcatccggatcgccacgccgggcggcctgcctgaaatcatcgaaagcgccggtgctgtcaccggttttgattcgggcgatggcgcgATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_tepidum_TLS                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:210 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G= -7.50 kcal/mol Antiterminator: Size=47 nt.     Delta G= -6.00 kcal/mol Anti-antiterminator:   Size=15 nt.     Delta G= -3.60 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GGCAAGATATTTATCACTCCTTTGGAGGAGTGCGTGAGGATCAGAACCAACGAACGAG GAGGTAGCGCTATCTGAttgataccgcttttgttatctgttcgctaagcgaaaagaaaatgccgcaaaggagaaatccctgcggcgtt ttcttttcataccgattctttatttcatctgtttccagccgggcgtggtggcgtcgagccagcgctcggcatccggatcgccacgccgggcggcctgcct gaaatcatcgaaagcgccggtgctgtcaccggttttgattcgggcgatggcgcgATG     CT0134 Gene: CT0135     GI: 21672976     BI number: CT0135     GOG: -------     Description: hypothetical protei             A           G  A           C  C           A  G           A  A            CG            CG           A  A           A  |           G  |           A  |            CG            TG            AT           G  A           G  |        A           A  |      G  t           G  |      T  t            TG        Cg   G        GC        Ta T  G       CG        At A  G       GC        Ta g  A      T  T      C  c cG       G  A       Gc gT        AT        Cg cG        GC        Gc gC        GT        At                         tttgttatctgttcgctaagcgaaaagaaaatgccgcaaaggagaaatccctgcggcgttttcttttcataccgattctttatttcatctgtttccagccgggcgtggtggcgtcgagccagcgctcggcatccggatcgccacgccgggcggcctgcctgaaatcatcgaaagcgccggtgctgtcaccggttttgattcgggcgatggcgcgATG     ..................................................................................................................