                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:35 nt.     Distance to run of Ts=3 nt.   Size=31 nt.     Delta G=-12.80 kcal/mol
Antiterminator: Size=27 nt.     Delta G= -6.40 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G=-17.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCATGGTCAGCCGCCCGGTTGACCTCCTTGCTGAACAGGCCCCTTCGCTCGCGCCATA
TCTTTTCGACGCATCCTTTTTCAGCGCGGCAACCCTTCTCTCCCATGCTTGTAAATCG
CTTGCGGAAGGTGCCGCGGGAACGGCCACCGGAACGCTTCCCGATTACCGGCAGGCGT
TTGTTCCTGCGCAGCGGCAGGGCTAAgccgacgcgctaccacccgtttttgccatgccggaacaggtcgttgctggcgggt
tactgttttgttttatggttagttcaatagcgcattattgctataTTG

    CT0139 Gene: CT0140     GI: 21672981     BI number: CT0140     GOG: COG0799     Description: iojap-related protei GC G  T G  A A  A Cg Gc Gc Cg G  a A  c                  g Cg                 g  t Gc                 a  c Cg         a        cg Gc       c  t       at T  t       cg        at C  a       gc       |  g C  c      t  c       gc T  |      t  g       gt T  |       tg        cg Gc        ta        cg Ta        ta        gc T  c       gc        tg T  c      c  a      a  | Gc        cg        cg Cg        cg        cg Gt        at        gt                         tactgttttgttttatggttagttcaatagcgcattattgctataTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG0799 Uncharacterized homolog of plant Iojap protein ... can be seen here     ..................................................................................................................