Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:88 nt.    Distance to gene:44 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G= -9.80 kcal/mol
Antiterminator:    Distance from promoter:42 nt. Size=64 nt.     Delta G= -8.51 kcal/mol
Anti-antiterminator:    Distance from promoter:24 nt.    Size=26 nt.     Delta G= -6.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgcat-tatatt. It has a score value of 66.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgcatcgacagccgtcgtgccgtatatttttgttaaggcgaaaaattgcctagggttaagtattgtctgcccgaacccgccgttaagagaatttctcca
tacaaccacgacatcatctctttgctgtgaccaggtcatatgcgggagtttttttgccgtccaaaacttttttctgaaaaaaggaagaggggatacccAT
G

    CT0163 --- CT0162


Gene: CT0163     GI: 21673004     BI number: CT0163     GOG: COG0674,COG1014     Description: alpha oxoglutarate ferredoxin oxidoreductase, alpha subunit
Gene: CT0162     GI: 21673003     BI number: CT0162     GOG: COG1013     Description: alpha oxoglutarate ferredoxin oxidoreductase, beta subuni


            a
          c  a
          a  c
          t  c
          a  a
          c  c
          c  g
          t  a
          c  c
          t  a
          t  t
          t  c
          a  a
           at
           gc
           at
           gc         a
           at       c  g
           at        cg
  g       t  t       at
t  t       tg        gc
t  c       gc        ta
 at       c  t       gt
 tg        cg        ta
 gc        gt       |  t
|  c       cg        cg
a  c      c  a       gc
a  g      c  c      t  |
 ta       a  c       tg
 ta       a  a       tg
 gc       g  |       cg
 gc        cg        ta
 gc        cg        cg
                        tttttttgccgtccaaaacttttttctgaaaaaaggaagaggggatacccATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[C] COG0674 Pyruvate:ferredoxin oxidoreductase and related 2-oxoacid:ferredoxin oxidoreductases, alpha subunit ... can be seen here
[C] COG1014 Pyruvate:ferredoxin oxidoreductase and related 2-oxoacid:ferredoxin oxidoreductases, gamma subunit ... can be seen here
[C] COG1013 Pyruvate:ferredoxin oxidoreductase and related 2-oxoacid:ferredoxin oxidoreductases, beta subunit ... can be seen here

    ..................................................................................................................