                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:84 nt.    Distance to gene:22 nt.     Distance to run of Ts=3 nt.   Size=28 nt.     Delta G= -8.10 kcal/mol
Antiterminator:    Distance from promoter:59 nt. Size=40 nt.     Delta G=-11.00 kcal/mol
Anti-antiterminator:    Distance from promoter:22 nt.    Size=52 nt.     Delta G=-15.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGACC-GAAATT. It has a score value of 68.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGACCTGAGTGGCGAGGCATATGAAATTTATCTCGACAATCCTGCCGAAACAGCGCC
TGACCAGCTCAGAACGCGAGTCTCTCTGATGCTTCACGAAAGCTGAcgggaattctcttttcgtgg
cggcgattatgaaaagaaacttttctcattcaatcgccgcgagcctctcATG

   ف --- CT0179 --- CT0180 Gene: CT0180     GI: 21673021     BI number: CT0180     GOG: COG1233     Description: lycopene cyclase, putative Gene: CT0181     GI: 21673022     BI number: CT0181     GOG: COG4277     Description: conserved hypothetical protein Gene: CT0182     GI: 21673023     BI number: CT0182     GOG: NOG13102     Description: conserved hypothetical protei CG G  A CG AT |  C |  T |  C AT GC AT         g CG       g  a TA       g  a |  T      c  t CG        At GC        Gc AT       T  t C  |      C  c       gc C  |       Gt       g  g AT        At       c  a GC        At        gt TA        At        gt |  C       Gc        ta |  G       Cg        gt C  A       At        cg C  A       Cg        ta G  A       Tg        ta CG       |  c       ta GC        Tg        ta AT        Cg        cg CG        Gc        ta                         aacttttctcattcaatcgccgcgagcctctcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [Q] COG1233 Phytoene dehydrogenase and related proteins ... can be seen here [R] COG4277 Predicted DNA-binding protein with the Helix-hairpin-helix motif ... can be seen here     ..................................................................................................................