                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:83 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G= -7.60 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -5.59 kcal/mol
Anti-antiterminator:   Size=33 nt.     Delta G= -8.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGTTCGCAAAGATGGAAGCCGATGAATCCGGCAGCGCCGGTAACGAGGATTTTCATgc
agtgtgtatgatttgaagcccatctgtggggctgttttcgggagcaggtacgccacaatctggcggttcgactgcgccgggaatgtgtttgtgaacTTA
AAGATAATCAGCTTTTTGGGAAAAAAGCGTTTCATTCAGGATGAAAACGAACGCTGTT
TTTGCCCATTGTCTGCTCTGTCGAAAATAGGGTATCTTTCTGCCTGCAATGATACAAT
CATTTTTCAAccgatgaaccgtgcttcATG

    CT0232 --- cdsA Gene: CT0232     GI: 21673071     BI number: CT0232     GOG: COG1266     Description: conserved hypothetical protein Gene: cdsA     GI: 21673072     BI number: CT0233     GOG: COG0575     Description: phosphatidate cytidylyltransferas            GG           G  A            TA            TA            TA            TA            TA            CG            GC           A  G           C  T   g       T  | g  a      A  |        G g  a      A  |      G  A c  t      T  |      A  T cg       A  |       CG gt       G  |       TA cg       A  |       TA gt       A  |      |  A t  t      A  |      A  A c  t      T  |      C  C a  g      T  |       TG gt       c  |       TA cg        aT        TA ta        aT        GC ta        gC        CG gc        tA        GC gT        gT        AT                         GTTTTTGCCCATTGTCTGCTCTGTCGAAAATAGGGTATCTTTCTGCCTGCAATGATACAATCATTTTTCAAccgatgaaccgtgcttcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1266 Predicted metal-dependent membrane protease ... can be seen here [I] COG0575 CDP-diglyceride synthetase ... can be seen here     ..................................................................................................................