                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:30 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-13.20 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -3.20 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G= -5.92 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cgtctgattggtttgactttttttgtcaggagcgatgatcgtatggggggcggcctctcatcgttttcttcttccgccggacgccaggcgcaggttgagg
aggcagagtatgaagtgatcgacagccagatcaaacaaaaggagtaaaacgcgcagattgcgcgatagtttttggtttgtgttcgattttttttatatat
tgtaagtcattggagcactagtctgttaaaagcaaagtttctgaaagtgggggatccccacttttttgttttcggaaattcgagcgaagcaattgatgcg
ATG

    CT0239 Gene: CT0239     GI: 21673078     BI number: CT0239     GOG: COG0779     Description: conserved hypothetical protei   a t  t a  t tg        ta at       t  a ta       g  a ta        ta tg        cg t  t      t  c t  c      g  a t  a      a  a t  t       ta t  t       cg a  g       at g  |      c  | cg        gt         a ta        at       g  t tg        gc        gc gc        gt        gc ta       |  g       gc gc       |  a       gc |  t      |  a       ta t  a       ta        gc t  g       tg        at t  t       at        at gc        cg        at gt        tg        gt                         ttgttttcggaaattcgagcgaagcaattgatgcgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG0779 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_tepidum_TLS                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:125 nt.     Distance to run of Ts=3 nt.   Size=15 nt.     Delta G= -7.80 kcal/mol Antiterminator: Size=67 nt.     Delta G= -9.90 kcal/mol Anti-antiterminator:   Size=36 nt.     Delta G=-13.80 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case cgtctgattggtttgactttttttgtcaggagcgatgatcgtatggggggcggcctctcatcgttttcttcttccgccggacgccaggcgcaggttgagg aggcagagtatgaagtgatcgacagccagatcaaacaaaaggagtaaaacgcgcagattgcgcgatagtttttggtttgtgttcgattttttttatatat tgtaagtcattggagcactagtctgttaaaagcaaagtttctgaaagtgggggatccccacttttttgttttcggaaattcgagcgaagcaattgatgcg ATG     CT0239 Gene: CT0239     GI: 21673078     BI number: CT0239     GOG: COG0779     Description: conserved hypothetical protei            ag           c  c           a  c           g  a            cg            ta            at            gc            ta           g  a           a  a           a  |            gc            ta           a  a           t  a           g  a           a  g   a       g  g c  g      a  a cg        cg gc        gt cg       g  a a  c      a  a g  a      g  | g  |      g  | cg       a  | cg       g  | gt        ta c  t       ta         a cg        gc       g  t ta       g  |      a  t tg       a  |       cg cg        cg        gc ta        gc        cg tg        cg        gc cg        gc        cg                         atagtttttggtttgtgttcgattttttttatatattgtaagtcattggagcactagtctgttaaaagcaaagtttctgaaagtgggggatccccacttttttgttttcggaaattcgagcgaagcaattgatgcgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG0779 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................